Entry information : AruPrx23 (PrxC3 / HRAPRXC3)
Entry ID 56
Creation 2006-09-05 (Christophe Dunand)
Last sequence changes 2014-05-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-06-12 (Christophe Dunand)
Peroxidase information: AruPrx23 (PrxC3 / HRAPRXC3)
Name (synonym) AruPrx23 (PrxC3 / HRAPRXC3)
Class Class III peroxidase    [Orthogroup: Prx040]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Armoracia
Organism Armoracia rusticana (horseradish)    [TaxId: 3704 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AruPrx23
start..stop
S start..stop
AlyPrx23 650 0 1..349 1..349
AlyPrx22 645 0 1..349 1..349
AhalPrx38 645 0 1..349 1..349
AtPrx23 644 0 1..349 1..349
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 485..712 228 N° 2 879..1070 192 N° 3 1202..1370 169 N° 4 1865..2325 461
join(485..712,879..1070,1202..1370,1865..2325)


exon

Literature and cross-references AruPrx23 (PrxC3 / HRAPRXC3)
Literature Fujiyama,K., Takemura,H., Shinmyo,A., Okada,H. and Takano,M. Genomic DNA structure of two new horseradish-peroxidase-encoding genes. Gene 89 (2), 163-169 (1990)
Protein ref. UniProtKB:   P17180
DNA ref. GenBank:   D90116.1
Protein sequence: AruPrx23 (PrxC3 / HRAPRXC3)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   349 (320)
PWM (Da):   %s   38042.16 (35148.7)  
PI (pH):   %s   7.6 (7.68) Peptide Signal:   %s   cut: 30 range:30-349
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGFSPLISCSAMGALILSCLLLQASNSNAQLRPDFYFRTCPSVFNIIGDIIVDELRTDPRIAASLLRLHFHDCFVRGCDASILLDNSTSFRTEKDAAPNANSARGFGVIDRMKTSLERACPRTVSCADVLTIASQISVLLSGGPWWPVPLGRRDSVEAFFDLANTALPSPFFTLAQLKKAFADVGLNRPSDLVALSGGHTFGRAQCQFVTPRLYNFNGTNRPDPTLDPTYLVQLRALCPQNGNGTVLVNFDVVTPNTFDRQYYTNLRNGKGLIQSDQELFSTPGADTIPLVNLYSSNTFAFFGAFVDAMIRMGNLRPLTGTQGEIRQNCRVVNSRIRGMENDDGVVSSI

Retrieve as FASTA  
Remarks Complete sequence from Genomic (3 introns) and cDNA
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGTTTTCTCCTCTCATTTCCTGCAGTGCTATGGGAGCCCTAATATTGAGTTGCCTTCTGCTTCAAGCTTCAAACTCTAATGCTCAGTTGAGGCCTGACTTCTACTTTAGGACTTGC
CCATCTGTTTTCAATATTATTGGGGATATCATTGTCGATGAACTGAGGACTGATCCTCGTATTGCCGCTAGCCTTCTTCGCCTTCACTTTCATGACTGCTTTGTTCGT
GTAAGTGTAAGG
ACTTAACTTTTTTTTTTTAAACTATGACGTGTTCATTGGACGTAACTACTTTTCACCATTTAATTCACATATAGAATAGAGGCCAAAAGGAATATTCGAATCAATAAATACAAGCGTCAT
ATAATGTCATATATATATATATATAATTTTGTAGGGTTGTGATGCATCGATCCTGCTTGACAATTCCACGTCGTTCCGAACCGAAAAAGATGCTGCTCCAAACGCAAATTCAGCTAGAGG
ATTTGGTGTCATAGATAGAATGAAAACATCCCTTGAGAGAGCTTGCCCAAGAACAGTGTCTTGTGCAGATGTTCTCACCATCGCCTCTCAAATATCAGTGCTTTTG
GTATGTACATGATT
TATAACGGATGATATTAATCCAATATGTTATGGATTTGACGTCAATGCTTTATAAGTTATGAAATTTGATTCAAAATGTTATGAATTTGATGTCAATTCTTTATATATATGTTATAGTCG
GGAGGTCCATGGTGGCCGGTTCCGTTGGGGAGGAGAGACAGCGTCGAAGCTTTCTTCGATTTGGCTAATACAGCTCTTCCCTCTCCATTTTTCACTCTTGCTCAACTTAAAAAAGCTTTC
GCTGACGTTGGCCTAAACCGCCCCTCAGATCTAGTCGCTCTTTCTG
GTAAAATATTCATGATGTTTCTAATATAAGTGTTTTTGATCTAGCTAGATCTATGCAATTCATTTTATATAATG
ATAGCTAAATGGATGCACTCCTCCACTAAGTCTGGAATTTACATATTAATTTATAAGTTATAGAATTACAAATTTATAATTCAAATTTTATTATTTTGAATTCTATTAATATGATCTACT
ATTATAATTCATATTTATTTTGTAATTTCTTAGGAATGATTTGCTTTTGGCTTTGAAATGCATGACCAAGTATAAAATAAATTAAAAAAGGATAATATAATTAAATAATAAATAATACCA
TCTCAAACAAAATGTCTTCAAGCACGTGATTTTGAATTAAAACATGAATTAGTAAAACGAAAAAATCATGACTTTTTTGTTGTCAAACTTTTTGTTTTTTTTTTTTAATTTTCCAACTGA
CAAACCATAAAAACTTAAACATGCAATGTATCTAAACCTTAGTTATTGTCAAAATGGTAGGTGGTCACACATTTGGAAGAGCACAATGCCAATTTGTGACACCTCGTCTCTACAACTTCA
ACGGTACAAACAGACCAGACCCAACTCTGGACCCAACTTACCTTGTCCAACTCCGTGCATTGTGCCCTCAAAACGGAAACGGCACCGTTCTGGTCAACTTCGATGTCGTGACTCCGAATA
CTTTTGATCGTCAATACTACACCAATCTTCGTAATGGGAAAGGTCTGATTCAGAGTGACCAAGAGCTCTTCTCGACTCCAGGAGCCGACACGATCCCACTAGTAAACCTATACAGCAGCA
ACACGTTCGCGTTCTTCGGAGCATTCGTTGATGCAATGATTAGGATGGGAAATCTTAGACCTTTGACTGGAACTCAAGGCGAGATAAGACAGAATTGTAGGGTTGTGAATTCGCGAATTA
GGGGTATGGAGAACGATGATGGAGTTGTGAGTTCTATTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGTTTTCTCCTCTCATTTCCTGCAGTGCTATGGGAGCCCTAATATTGAGTTGCCTTCTGCTTCAAGCTTCAAACTCTAATGCTCAGTTGAGGCCTGACTTCTACTTTAGGACTTGC
CCATCTGTTTTCAATATTATTGGGGATATCATTGTCGATGAACTGAGGACTGATCCTCGTATTGCCGCTAGCCTTCTTCGCCTTCACTTTCATGACTGCTTTGTTCGT
GGTTGTGATGCA
TCGATCCTGCTTGACAATTCCACGTCGTTCCGAACCGAAAAAGATGCTGCTCCAAACGCAAATTCAGCTAGAGGATTTGGTGTCATAGATAGAATGAAAACATCCCTTGAGAGAGCTTGC
CCAAGAACAGTGTCTTGTGCAGATGTTCTCACCATCGCCTCTCAAATATCAGTGCTTTTG
TCGGGAGGTCCATGGTGGCCGGTTCCGTTGGGGAGGAGAGACAGCGTCGAAGCTTTCTTC
GATTTGGCTAATACAGCTCTTCCCTCTCCATTTTTCACTCTTGCTCAACTTAAAAAAGCTTTCGCTGACGTTGGCCTAAACCGCCCCTCAGATCTAGTCGCTCTTTCTG
GTGGTCACACA
TTTGGAAGAGCACAATGCCAATTTGTGACACCTCGTCTCTACAACTTCAACGGTACAAACAGACCAGACCCAACTCTGGACCCAACTTACCTTGTCCAACTCCGTGCATTGTGCCCTCAA
AACGGAAACGGCACCGTTCTGGTCAACTTCGATGTCGTGACTCCGAATACTTTTGATCGTCAATACTACACCAATCTTCGTAATGGGAAAGGTCTGATTCAGAGTGACCAAGAGCTCTTC
TCGACTCCAGGAGCCGACACGATCCCACTAGTAAACCTATACAGCAGCAACACGTTCGCGTTCTTCGGAGCATTCGTTGATGCAATGATTAGGATGGGAAATCTTAGACCTTTGACTGGA
ACTCAAGGCGAGATAAGACAGAATTGTAGGGTTGTGAATTCGCGAATTAGGGGTATGGAGAACGATGATGGAGTTGTGAGTTCTATTTGA

Retrieve as FASTA