Entry information : GmPrx69 (Glyma09g02610.1)
Entry ID 568
Creation 2005-06-21 (Christophe Dunand)
Last sequence changes 2011-07-04 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-16 (Christophe Dunand)
Peroxidase information: GmPrx69 (Glyma09g02610.1)
Name (synonym) GmPrx69 (Glyma09g02610.1)
Class Class III peroxidase    [Orthogroup: Prx044]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue types Roots hairs
Roots of 'Supernod' plants
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx69
start..stop
S start..stop
GmPrx260 666 0 14..347 15..349
PvPrx01 613 0 14..347 14..348
PvPrx08 573 0 6..347 13..355
MsPrx15 573 0 1..346 7..352
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1789869..1790075 207 N° 2 1790347..1790538 192 N° 3 1791080..1791245 166 N° 4 1791333..1791811 479
join(1789869..1790075,1790347..1790538,1791080..1791245,1791333..1791811)


exon

Literature and cross-references GmPrx69 (Glyma09g02610.1)
Literature Vodkin,L.,et al, A Functional Genomics Program for Soybean.
Scheffler,et al, Expressed sequence tags from soybean root hair subtractive cDNA.
DNA ref. Phytozome 11:   Gm09 (1789869..1791811)
Protein sequence: GmPrx69 (Glyma09g02610.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   348 (325)
PWM (Da):   %s   37245.58 (34900.3)  
PI (pH):   %s   5.3 (5.29) Peptide Signal:   %s   cut: 23 range:23-347
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKVTVVCCVLVVLGALPFSSDAQLDPSFYRDTCPKVHSIVREVVRNVSKSDPRMLASLIRLHFHDCFVQGCDASILLNNTATIESEQQAFPNNNSIRGLDVVNQIKTAVENACPGVVSCADILALAAEISSVLGHGPDWKVPLGRRDSLTANRTLANQNLPAPFFNLTQLKDAFAVQGLNTTDLVALSGAHTIGRAQCRFFVDRLYNFSSTGNPDPTLNTTYLQTLSAICPNGGPGTNLTNFDPTTPDTVDSNYYSNLQVNKGLLQSDQELFSTTGADTIAIVNSFSSNQTLFFENFKASMIKMGNIGVLTGSQGEIRQQCNFINGNSAGLATLATKESSDGMVSSI*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and 6 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAGTAACAGTTGTGTGTTGTGTATTGGTTGTGCTTGGTGCACTACCATTCTCTTCGGATGCACAACTAGACCCCTCCTTTTATAGGGACACATGTCCCAAAGTGCATTCTATTGTA
CGTGAAGTTGTTAGAAACGTTTCAAAATCAGACCCTCGAATGCTTGCTAGTCTCATAAGGCTCCACTTTCATGACTGCTTTGTTCAA
GTATGTTTCATGTTTGTTCATCACTTTTCCTAA
GTTTGGTGTCATTGTCAACTCCATTTTGTTACACTTACACATTCATCAGTTTTCACTTTAAGCTAATTGAGTCCTTCCTACTTAATTTCAAAAGTACAACTCATTTTCAATCCGAACAAC
ATTGAAAATATTTTACAAATTCTTCTGCCATCAATGTACTATTTAGTCTTATGTTTATGTCATATGTGTTAATAAGTAATAAGTTTATTAAGATGTTTCTCATGTTTGTGGCATGCAGGG
CTGTGATGCATCAATTTTGTTGAACAACACAGCCACAATAGAAAGTGAGCAACAAGCTTTCCCAAACAACAACTCAATAAGAGGTTTGGATGTTGTGAACCAGATCAAGACTGCGGTGGA
AAATGCTTGTCCTGGTGTAGTTTCTTGTGCTGATATTCTTGCCCTTGCAGCTGAGATATCTTCTGTTCTG
GTATGTCTCACTCCTATTTTTAAATAAATTTCTTCTAACATTATTGGATG
CCATTACTTTCCACTTTATAAGTTGAGACCATCTCCATGTTTAGTGTGTTGTCTAAATGTGCATATTATCTAAATTGTAATCCTTAATTATGCCTAATATTTTAACTTTTCTTTCTTTTA
GTTTCTAGAATGTGTCAATTTTAATTGTTAACTGACATACGAAAGGAGGTTTTGCTTCTTAAAATCACTTTTCTCTGATTTCATTAGCAATCTTTTCTAAGATTACTTCATATACTTTAA
GACCAATTTTATGGTCTCCCATAAACCCTCGCTCATAAATTAAGTGACTATTTAAGAAGACAGAGAAAATGAAAGTGAGTTGATGAATTAGTTAAAACAAATTATTAGTAAGGAATGTCT
ACTCGCAGCCAACTTTGAAAAATAAATACTATAACATTCTTAATATATTGTGTTAAATCAAAGTCCAAGTTAACAGGTATGACTTTTGCTTTTACTTTATTATCCCTTCTAAAATTTACA
ACCATGCACAGGGTCATGGTCCTGATTGGAAAGTTCCATTGGGTAGAAGGGACAGTTTAACAGCAAACAGAACACTTGCAAATCAAAATCTTCCAGCTCCATTCTTCAACCTTACTCAAC
TTAAAGATGCCTTTGCTGTTCAAGGTCTCAATACTACTGATCTAGTTGCACTCTCAG
GTACATATGAACCTTTTCACACTTCAGAAAATTCATCTCTATAATTATAAAAAAAATGGCAGC
ACATTTTGAGTCTTCATTTTTCAGGTGCCCATACAATTGGTAGAGCTCAGTGCAGATTTTTCGTCGACCGATTATACAATTTCAGCAGCACTGGCAATCCTGATCCAACTCTTAACACAA
CTTACTTGCAAACACTCAGTGCAATATGCCCCAATGGTGGACCTGGCACTAACCTCACCAATTTTGACCCAACCACACCTGACACAGTGGACAGTAACTACTACTCCAATCTTCAGGTTA
ACAAGGGCTTGCTTCAGAGTGACCAAGAGCTGTTTTCCACAACCGGTGCTGATACCATTGCCATTGTCAATAGCTTCAGCAGTAACCAAACTCTTTTCTTTGAGAACTTCAAGGCTTCAA
TGATAAAAATGGGTAACATTGGAGTGCTAACGGGATCTCAAGGAGAAATCAGACAACAATGTAATTTTATTAATGGGAATTCTGCTGGATTGGCTACTCTTGCCACCAAAGAATCATCAG
ATGGCATGGTTAGCTCAATCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAGTAACAGTTGTGTGTTGTGTATTGGTTGTGCTTGGTGCACTACCATTCTCTTCGGATGCACAACTAGACCCCTCCTTTTATAGGGACACATGTCCCAAAGTGCATTCTATTGTA
CGTGAAGTTGTTAGAAACGTTTCAAAATCAGACCCTCGAATGCTTGCTAGTCTCATAAGGCTCCACTTTCATGACTGCTTTGTTCAA
GGCTGTGATGCATCAATTTTGTTGAACAACACA
GCCACAATAGAAAGTGAGCAACAAGCTTTCCCAAACAACAACTCAATAAGAGGTTTGGATGTTGTGAACCAGATCAAGACTGCGGTGGAAAATGCTTGTCCTGGTGTAGTTTCTTGTGCT
GATATTCTTGCCCTTGCAGCTGAGATATCTTCTGTTCTG
GGTCATGGTCCTGATTGGAAAGTTCCATTGGGTAGAAGGGACAGTTTAACAGCAAACAGAACACTTGCAAATCAAAATCTT
CCAGCTCCATTCTTCAACCTTACTCAACTTAAAGATGCCTTTGCTGTTCAAGGTCTCAATACTACTGATCTAGTTGCACTCTCAG
GTGCCCATACAATTGGTAGAGCTCAGTGCAGATTT
TTCGTCGACCGATTATACAATTTCAGCAGCACTGGCAATCCTGATCCAACTCTTAACACAACTTACTTGCAAACACTCAGTGCAATATGCCCCAATGGTGGACCTGGCACTAACCTCACC
AATTTTGACCCAACCACACCTGACACAGTGGACAGTAACTACTACTCCAATCTTCAGGTTAACAAGGGCTTGCTTCAGAGTGACCAAGAGCTGTTTTCCACAACCGGTGCTGATACCATT
GCCATTGTCAATAGCTTCAGCAGTAACCAAACTCTTTTCTTTGAGAACTTCAAGGCTTCAATGATAAAAATGGGTAACATTGGAGTGCTAACGGGATCTCAAGGAGAAATCAGACAACAA
TGTAATTTTATTAATGGGAATTCTGCTGGATTGGCTACTCTTGCCACCAAAGAATCATCAGATGGCATGGTTAGCTCAATCTAA

Retrieve as FASTA