Entry information : GmPrx71 (Glyma02g28880.1)
Entry ID 570
Creation 2005-06-21 (Christophe Dunand)
Last sequence changes 2011-07-04 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-12-13 (Qiang Li)
Peroxidase information: GmPrx71 (Glyma02g28880.1)
Name (synonym) GmPrx71 (Glyma02g28880.1)
Class Class III peroxidase    [Orthogroup: Prx005]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type Roots
Inducers Bradyrhizobium japonicus infection
Nodulation
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx71
start..stop
S start..stop
GmPrx38 612 0 1..331 1..331
PvPrx05 578 0 1..331 1..334
GmPrx136 547 0 9..331 7..330
MtPrx23 542 0 1..331 45..373
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 30140842..30141057 216 N° 2 30140489..30140683 195 N° 3 30139905..30140070 166 N° 4 30139068..30139486 419
complement(join(30139068..30139486,30139905..30140070,30140489..30140683,3014084 2..30141057))


exon

Literature and cross-references GmPrx71 (Glyma02g28880.1)
Literature Public Soybean EST Project.
DNA ref. Phytozome 12:   Gm02 (30141057..30139068)
Protein sequence: GmPrx71 (Glyma02g28880.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   332 (306)
PWM (Da):   %s   35038.02 (32163.6)  
PI (pH):   %s   4.34 (4.40) Peptide Signal:   %s   cut: 26 range:26-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLSTNTYSLPTTIFLVLTFLFPSEAQLNATFYSSTCPNVSSIVSNAVQQALQSDSRIGASLIRLHFHDCFVNGCDASILLDQGGNITQSEKNAVPNFNSVRGFDIVDNIKSSLESSCPGVVSCADILALAAESSVSLSGGPSWNVLLGRRDGLTANQAGANSSLPSPFESLANVSSKFSAVGLDTTDLVALSGAHTFGRSQCQFFSQRLFNFSGTGSPDPTLNSTYLATLQQNCPQNGNGSTLNNLDPSTPDTFDNNYFTNLLINQGLLQTDQELFSTNGSSTISIVNNFANNQSAFFAAFAQSMINMGNISPLTGTQGEIRTDCKKVNGS*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 2 ESTs (DY577376).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTTCTACTAATACTTATTCCCTTCCGACCACCATTTTCTTAGTGCTAACCTTTCTCTTCCCTTCAGAAGCTCAATTGAATGCAACCTTCTATTCTAGCACATGCCCCAATGTGTCT
TCTATCGTGAGCAATGCTGTTCAGCAGGCTCTGCAATCTGATTCCCGAATTGGTGCAAGCCTCATTCGCCTCCACTTTCATGATTGTTTTGTCAAT
GTAAACCTCCATTTATTTTATTCT
CAAGAATAATTAAGGTTGATAATTTATATATATTAGACGACTAATAATTTATTTTTGGCGTATATATATTTTTCCTAACTTTTTTTGTATTAGAGGACTAATAATTAATATAAATGTTAT
TGTTTCTGTTTTAGGGGTGTGATGCGTCCATATTGTTAGACCAGGGTGGTAACATCACACAAAGTGAGAAAAATGCAGTTCCTAACTTCAATTCCGTTCGGGGCTTTGATATTGTTGATA
ACATCAAGAGCTCCCTCGAAAGCTCTTGCCCTGGAGTCGTATCTTGTGCTGATATTCTTGCACTTGCAGCAGAATCTTCTGTGTCCTTG
GTAACTACCTAGCTATTACTTGATTTTTCTT
TCCTAACACATACTCTCTCTTCCATTATAATTGTGATTATTTTAAATCCGAGTAAGAAAAAATAATAATAGATTAAAGGTAATAGTAATTTTATAAAATTAATATTATTGTTTTTAATTT
TTTTTTACTTATCACTAATATTATAAGAAATATAAATGAAAAAAAAAATAATGTTATATTAAAAAACTAAAATGATAATTTTTTAAATATTTATGTTTCTTCTTATGAGACAAAAAGAGT
AATATAGGATATTGTATTTACTCAAACATTCCATATAAAGGAGTATCATTTATGACATTTATTACCTTTCTTCTGTGTCGTCTCTCTTGTTTTTACTCATACACTTGTGTCTGTAAGGGT
TCTTTAATAAAGTGTAGAAATTTGCAGTCAGGAGGTCCTTCATGGAACGTACTACTCGGAAGAAGGGATGGTCTAACTGCAAACCAAGCTGGTGCCAATAGCTCCCTTCCTTCTCCATTT
GAGAGCCTAGCCAATGTCTCATCCAAATTCTCTGCGGTTGGCCTAGACACAACCGATCTTGTTGCATTATCTG
GTTGGTAACTACAATACATCTTCTATTCTTTTTTTAACTGAACTAGA
ATACATCTTTTTTTACACTAAAAAAAATTATTATATGATCTACTATTATGTGATCTTTATTAATCTTCATATGATATTCAGTTTTCCAAATAAAAGTTTATATTTCTTTAGTCTTTCAAA
TTCAAAAAAAGTTCTCTTTAGTCTCTTTCAAATAAAAATTTATAATTTTTTATTCTCTCAATTTCTGACAAAGTGACTACAAAAAATACTTTTGAACAAAAAAAATAGACATCTTAATTT
AAAAGGCTAAAAAATAGTATGACTTATCACATAAAGATTAGTCAAATTAATAATCTTGCAGCATGTAAAATTTATGCTTTCCATGCACAAATTTTACAAAATGGTTGACTCAAATTTCAC
TTTTTCATTAGGTGCACACACTTTTGGTCGTTCCCAATGTCAATTTTTCTCCCAAAGGTTGTTCAACTTCAGCGGCACAGGAAGTCCTGATCCAACCCTAAACTCAACCTATTTGGCCAC
TCTGCAGCAAAATTGTCCCCAAAACGGAAATGGGTCTACATTGAACAATCTTGATCCTTCAACCCCTGACACTTTTGACAACAACTATTTCACCAATCTTCTCATCAACCAAGGTCTTCT
TCAAACAGATCAAGAACTCTTCTCTACGAATGGCTCTTCCACAATCTCCATTGTTAACAACTTTGCCAACAACCAATCAGCCTTCTTCGCAGCATTTGCTCAGTCGATGATCAACATGGG
TAACATCAGCCCTTTGACTGGAACTCAAGGAGAAATCAGAACAGATTGTAAGAAAGTGAATGGAAGTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTTCTACTAATACTTATTCCCTTCCGACCACCATTTTCTTAGTGCTAACCTTTCTCTTCCCTTCAGAAGCTCAATTGAATGCAACCTTCTATTCTAGCACATGCCCCAATGTGTCT
TCTATCGTGAGCAATGCTGTTCAGCAGGCTCTGCAATCTGATTCCCGAATTGGTGCAAGCCTCATTCGCCTCCACTTTCATGATTGTTTTGTCAAT
GGGTGTGATGCGTCCATATTGTTA
GACCAGGGTGGTAACATCACACAAAGTGAGAAAAATGCAGTTCCTAACTTCAATTCCGTTCGGGGCTTTGATATTGTTGATAACATCAAGAGCTCCCTCGAAAGCTCTTGCCCTGGAGTC
GTATCTTGTGCTGATATTCTTGCACTTGCAGCAGAATCTTCTGTGTCCTTG
TCAGGAGGTCCTTCATGGAACGTACTACTCGGAAGAAGGGATGGTCTAACTGCAAACCAAGCTGGTGCC
AATAGCTCCCTTCCTTCTCCATTTGAGAGCCTAGCCAATGTCTCATCCAAATTCTCTGCGGTTGGCCTAGACACAACCGATCTTGTTGCATTATCTG
GTGCACACACTTTTGGTCGTTCC
CAATGTCAATTTTTCTCCCAAAGGTTGTTCAACTTCAGCGGCACAGGAAGTCCTGATCCAACCCTAAACTCAACCTATTTGGCCACTCTGCAGCAAAATTGTCCCCAAAACGGAAATGGG
TCTACATTGAACAATCTTGATCCTTCAACCCCTGACACTTTTGACAACAACTATTTCACCAATCTTCTCATCAACCAAGGTCTTCTTCAAACAGATCAAGAACTCTTCTCTACGAATGGC
TCTTCCACAATCTCCATTGTTAACAACTTTGCCAACAACCAATCAGCCTTCTTCGCAGCATTTGCTCAGTCGATGATCAACATGGGTAACATCAGCCCTTTGACTGGAACTCAAGGAGAA
ATCAGAACAGATTGTAAGAAAGTGAATGGAAGTTAA

Retrieve as FASTA