Entry information : SbGPx03 (Sobic.004G290100.1[2.1] / nd[1.4])
Entry ID 5737
Creation 2007-08-16 (Christophe Dunand)
Last sequence changes 2011-01-20 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-08-06 (Christophe Dunand)
Peroxidase information: SbGPx03 (Sobic.004G290100.1[2.1] / nd[1.4])
Name (synonym) SbGPx03 (Sobic.004G290100.1[2.1] / nd[1.4])
Class Plant glutathione peroxidase    [Orthogroup: Gpx2001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue types Flowers
Roots
Seedlings
Shoots
Inducers Brassinolide treatment
Gibberellic acid treatment
Repressor N/D
Best BLASTp hits
Perox score E-value SbGPx03
start..stop
S start..stop
ZmGPx03 437 5e-158 1..247 1..245
TaGPx03-1A 353 6e-125 1..247 1..236
OsGPx03 353 8e-125 1..247 1..237
SpGPx01 336 2e-119 81..247 1..167
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 62469503..62469790 288 N° 2 62469164..62469240 77 N° 3 62468443..62468504 62 N° 4 62468192..62468310 119
N° 5 62467690..62467857 168 N° 6 62467555..62467596 42  
complement(join(62467555..62467596,62467690..62467857,62468192..62468310,6246844 3..62468504,62469164..62469240,62469503..62469790))


exon

Literature and cross-references SbGPx03 (Sobic.004G290100.1[2.1] / nd[1.4])
Literature Cordonnier-Pratt,M.-M., Suzuki,Y., Sugano,S., Klein,R., Brady,J., Liang,C., Sun,F. and Pratt,L.H. A Sorghum EST database: seedlings treated with gibberellic acid or brassinolide.
DNA ref. Phytozome 11:   chromosome_4 (62469790..62467555)
Cluster/Prediction ref. UniGene:   Sbi.18388
Protein sequence: SbGPx03 (Sobic.004G290100.1[2.1] / nd[1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   251
PWM (Da):   %s   27292.16  
PI (pH):   %s   9.81
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPPSPAPLFSRLRFRLRTCAAVSISTRPSSAAPLRYRRTRLSIPFPLSPPCPRILRAAAAAAVSSSLDLRAIAGGFALFSMAAASSATSVHDFTVKDASGKDVDLSTYKGKVLLIVNVASQCGLTNSNYTELSQLYEKYKDGFEILAFPCNQFGGQEPGTNEEIVQFACTRFKAEYPIFDVDVNGDNTAPIYKFLKSSKGSLFGENIKWNFSKFLVDKEGRVVERYAPTTSPLSIEKDIKKLLGSPSTL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 5 introns) and 30 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTCCCAGCCCCGCCCCACTATTCTCTCGCCTGCGCTTCCGCCTCCGGACGTGCGCCGCCGTCTCCATCTCCACCCGTCCATCCTCCGCGGCGCCCCTGCGCTACCGTCGCACTCGC
CTCTCTATCCCTTTTCCTCTGTCCCCACCTTGCCCGCGCATCCTCCGCGCCGCCGCCGCCGCCGCGGTCTCGTCGTCGCTGGATCTGCGCGCGATAGCCGGCGGGTTCGCGCTGTTCAGC
ATGGCTGCTGCCTCCTCCGCCACATCCGTCCACGACTTCACCGTCAAG
GTGCGCAAAACGGCCCAATCTCGCGTGTATAAAATACCAACTCCATTTCCTTTTGAAAGCGAGTCACAAATC
TTGTACACATGTCCTCGCGGAGTTAAGCATTTGCACATAGATCCCTCCCTGATCCGGGTGCTTTTCAAGTTTTGTCTCACTCCAGTTTCCGTTGAAGATTGCTTCGTTCCTGAAAGTCTC
CGGATGTGCTATCATACTGATACCGTGTGGATTCTTTTCCTAAATGATCCTTTTTTTGTTGTTGATGCAGGATGCTAGCGGGAAAGATGTGGACCTTAGCACCTACAAGGGGAAGGTTCT
ACTCATAGTCAATGTTGCATCTCAGTG
GTACCAATTTACTGCTTTCTTAACACCATTTTCCATTACTTGCAAAATCATGATCATGGCTTGAAAAGTTATGTGGAATGCATCATGTAATCC
TCTTATTGATACTGAAGTGCTCCATGTTTCACGGTGAAACTGGCTGTAGGAGAGTGCTTTGATGCTTACTAGTGGCATATGCTCATTTAGTTCCTCTAATGTAGTGTACTTTATAATTTG
AGCTTTACGTTTGTGGATAAGTGGGATGGAGCTAACAAGTAAAGATACACATTATATGCTTTCTTATGCAATGATATTAGCAAATTCAAATTTAAAATTTTACCGTTAAATATATTGTGC
TAAACGCTTACCCTGAGCGCCATAGTTGTTTCTATTCTTGAGAATCAACATTTGAGTTATCCATGTGTGGGTGGAATTTGCCTGTTAAACAGACAGCGTGGTAGTGGTTGCAGTTGGACA
TCAAAATATTGGGAGACCTGCTTCCTGGACTATTTATGCAGTTTTAAGTGTCATGTTATTCTTTCCATTTCTATTTGTACATTAATGAATATATACGTTCTTGGATAGACTTTTTATCCC
TGATCTTGAGGTGCACATGTACCATTGTATAAGACTGTTGACTACTTTTGAGTTAACATGTCCACTTCTCTTTTATTCTGTTGCAGTGGCTTGACCAATTCCAACTACACAGAGCTGAGC
CAGTTGTATGAGAAGTACAAGGACCAGG
GTAAGTAATCTTTTGTGTCGTTATTTCTTAATTATGTAGTGTGTCTTGCGCATGCTCTGTTTCTCATATAGATTGGCTCCATGTCAAAACAT
GATTGATGTGCTAAATGTTGTCAATCTGATGTGACTTCAGGTTTTGAGATCCTTGCTTTCCCATGTAACCAGTTTGGTGGGCAGGAGCCTGGCACTAATGAGGAGATTGTCCAGTTTGCT
TGCACTCGCTTCAAGGCTGAATATCCAATTTTCGACAAG
GTAAATCTGCACACAACACTTATTTCTTTTGTCATTTTATTTTCCGAGGCACAAGTAAAAAAAAATTCTGCTCGACGTTCA
TGACCAGCTACAGTACTTTGATCTATGAAACCAAGCATTCTCTTTTTTTGTATATGTTGTCTGTTGTGAAATGTAATATTTGAACTAACTGTTCTGTTGCTAAGGCTACCTGACAATTGT
TTTTAAAAACAAATGGCGGGGATTAGGGTCAAGTTTCATTTATGCATCAGTAGAATTATCCATATGCTTGTGAATGTGATTCTAATTAGCAAGCATATAGGGAGTTTAAAGTTTTTAACT
TTCATTGTGTTAGGTTGATGTCAATGGTGACAATACTGCACCCATCTACAAGTTCCTGAAGTCCAGCAAAGGTAGTCTCTTTGGGGAGAACATAAAATGGAACTTCTCCAAGTTTTTGGT
TGACAAAGAGGGGCGTGTTGTGGAGCGGTACGCACCGACAACTTCCCCACTGAGCATCGAG
GTATGTTCCATTTTACATCGACCTGGTCGGTGGTATGGTCATTTGAATTTTCTTGTTTC
ATCTTTCAGCACTAACTTTGGCAAATTTTTGCAGAAGGACATCAAGAAGCTACTAGGGAGTCCTTCAACCTTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTCCCAGCCCCGCCCCACTATTCTCTCGCCTGCGCTTCCGCCTCCGGACGTGCGCCGCCGTCTCCATCTCCACCCGTCCATCCTCCGCGGCGCCCCTGCGCTACCGTCGCACTCGC
CTCTCTATCCCTTTTCCTCTGTCCCCACCTTGCCCGCGCATCCTCCGCGCCGCCGCCGCCGCCGCGGTCTCGTCGTCGCTGGATCTGCGCGCGATAGCCGGCGGGTTCGCGCTGTTCAGC
ATGGCTGCTGCCTCCTCCGCCACATCCGTCCACGACTTCACCGTCAAG
GATGCTAGCGGGAAAGATGTGGACCTTAGCACCTACAAGGGGAAGGTTCTACTCATAGTCAATGTTGCATCT
CAGTG
TGGCTTGACCAATTCCAACTACACAGAGCTGAGCCAGTTGTATGAGAAGTACAAGGACCAGGGTTTTGAGATCCTTGCTTTCCCATGTAACCAGTTTGGTGGGCAGGAGCCTGGC
ACTAATGAGGAGATTGTCCAGTTTGCTTGCACTCGCTTCAAGGCTGAATATCCAATTTTCGACAAG
GTTGATGTCAATGGTGACAATACTGCACCCATCTACAAGTTCCTGAAGTCCAGC
AAAGGTAGTCTCTTTGGGGAGAACATAAAATGGAACTTCTCCAAGTTTTTGGTTGACAAAGAGGGGCGTGTTGTGGAGCGGTACGCACCGACAACTTCCCCACTGAGCATCGAG
AAGGAC
ATCAAGAAGCTACTAGGGAGTCCTTCAACCTTGTAA

Retrieve as FASTA