Entry information : GmPrx77 ( Glyma10g38520.1)
Entry ID 576
Creation 2006-08-07 (Christophe Dunand)
Last sequence changes 2016-03-31 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-04-06 (Christophe Dunand)
Peroxidase information: GmPrx77 ( Glyma10g38520.1)
Name (synonym) GmPrx77 ( Glyma10g38520.1)
Class Class III peroxidase    [Orthogroup: Prx036]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type Floral meristems
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx77
start..stop
S start..stop
MtPrx13 592 0 1..322 1..322
GmPrx73 532 0 1..322 1..325
GmPrx185 530 0 1..322 1..325
MePrx90 513 0 8..322 9..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 46309760..46309975 216 N° 2 46310121..46310309 189 N° 3 46310665..46311228 564  
join(46309760..46309975,46310121..46310309,46310665..46311228)


exon

Literature and cross-references GmPrx77 ( Glyma10g38520.1)
Literature Public Soybean EST Project.
DNA ref. Phytozome 12:   Gm10 (46309694..46311228)
Protein sequence: GmPrx77 ( Glyma10g38520.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (297)
PWM (Da):   %s   35664.28 (32845.6)  
PI (pH):   %s   8.73 (8.74) Peptide Signal:   %s   cut: 26 range:26-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPLPAENILPIIFLLLIIFSVSKAELHAHYYDQTCPQVEKIISETVLKASKHDPKVPARILRMFFHDCFIRGCDASILLDSTATNQAEKDGPPNISVRSFYVIDEAKAKLELACPRTVSCADIIAISASNVVAMSGGPYWNVLKGRKDGRVSKASDTINLPAPTSNVSQLIQSFAKRGLTVKDLVTLSGGHTLGFSHCSSFEARLRNFSSLHDTDPSMNTEFALDLRKKCPKPNHNHNAGQFLDSTASVFDNDYYKQLLAGKGVFFSDQSLVGDHRTRWFVEAFVKDQSLFFKEFTASMLKLGNLRGSRNGEVRLNCRIVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCCCTCTGCCAGCAGAAAACATCTTACCAATCATTTTCCTCCTCTTGATAATATTTTCAGTATCCAAAGCTGAACTTCATGCTCATTACTATGACCAAACATGTCCACAAGTGGAA
AAAATAATTTCAGAGACTGTTCTCAAAGCTTCTAAGCATGACCCAAAAGTCCCAGCCCGTATCTTGAGAATGTTCTTCCATGACTGTTTCATAAGG
GTATGATCTTTCACTCAATAAAAT
AAAAAACACTAGCATGCATGCACACACAATATTCATACTGATGAATGATTAAAATGGCTTATGTGTGCTTATGTGTAATACTGTAATTGGTATATGATTATTGATTGATGTTCAATGGTA
GGGGTGTGATGCCTCAATATTGCTGGACTCAACAGCCACTAACCAAGCTGAGAAAGATGGCCCTCCTAATATCTCAGTTCGATCATTCTATGTGATTGATGAAGCCAAAGCAAAGCTTGA
ATTGGCTTGCCCACGCACTGTTTCTTGTGCTGATATAATTGCCATTTCAGCTAGCAATGTGGTAGCCATG
GTAATATCTAAGTCTCCAAACTGTTTTAGACCTGCTAAAATCTTGGTACT
CTTTAGTAGACATATTCGATGATCTCATAAAATATTCCATTGAAAGAATCTAAATCACATGATAGGTTTGGATAATGCCTAAATAAATTCTAGATAAATATTTAAAATTTCTATACACAC
TGATCACTCATTCCTGAGAATCTTGAATAGCATATAAATTATTATTCAGGATATTTAGTATGTTGGATATTATTATTGATCTCTACATTTCCATAATGATCACTCCATGAAACATTAGCA
TATCTTGAGGTAAGTGAAAGTAAGTTACTTATTACAATATCAATATTTCTTATTTACTATGACAGTCTGGAGGTCCATATTGGAATGTACTGAAAGGAAGGAAAGATGGAAGAGTATCAA
AGGCATCTGATACCATCAACTTACCCGCTCCAACCTCCAATGTGAGCCAACTAATTCAGAGCTTTGCTAAGAGAGGTTTGACAGTTAAAGATTTAGTAACTTTATCTGGAGGTCACACTC
TAGGCTTTTCACATTGTTCTTCCTTTGAGGCACGTCTTCGTAATTTTAGTTCATTGCATGACACTGATCCAAGTATGAACACCGAGTTTGCTTTAGACCTAAGAAAGAAATGTCCAAAAC
CAAACCACAACCATAATGCAGGACAGTTCCTGGACTCAACGGCATCAGTGTTTGACAATGACTATTATAAACAACTGTTGGCTGGAAAAGGTGTGTTTTTTTCAGATCAATCACTTGTTG
GTGATCACAGGACTAGATGGTTTGTTGAAGCATTTGTGAAAGACCAGAGCTTGTTCTTCAAAGAGTTTACAGCTTCAATGTTGAAACTTGGAAATTTAAGAGGCTCTAGAAATGGAGAAG
TGAGACTTAATTGCAGGATTGTGAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCCCTCTGCCAGCAGAAAACATCTTACCAATCATTTTCCTCCTCTTGATAATATTTTCAGTATCCAAAGCTGAACTTCATGCTCATTACTATGACCAAACATGTCCACAAGTGGAA
AAAATAATTTCAGAGACTGTTCTCAAAGCTTCTAAGCATGACCCAAAAGTCCCAGCCCGTATCTTGAGAATGTTCTTCCATGACTGTTTCATAAGG
GGGTGTGATGCCTCAATATTGCTG
GACTCAACAGCCACTAACCAAGCTGAGAAAGATGGCCCTCCTAATATCTCAGTTCGATCATTCTATGTGATTGATGAAGCCAAAGCAAAGCTTGAATTGGCTTGCCCACGCACTGTTTCT
TGTGCTGATATAATTGCCATTTCAGCTAGCAATGTGGTAGCCATG
TCTGGAGGTCCATATTGGAATGTACTGAAAGGAAGGAAAGATGGAAGAGTATCAAAGGCATCTGATACCATCAAC
TTACCCGCTCCAACCTCCAATGTGAGCCAACTAATTCAGAGCTTTGCTAAGAGAGGTTTGACAGTTAAAGATTTAGTAACTTTATCTGGAGGTCACACTCTAGGCTTTTCACATTGTTCT
TCCTTTGAGGCACGTCTTCGTAATTTTAGTTCATTGCATGACACTGATCCAAGTATGAACACCGAGTTTGCTTTAGACCTAAGAAAGAAATGTCCAAAACCAAACCACAACCATAATGCA
GGACAGTTCCTGGACTCAACGGCATCAGTGTTTGACAATGACTATTATAAACAACTGTTGGCTGGAAAAGGTGTGTTTTTTTCAGATCAATCACTTGTTGGTGATCACAGGACTAGATGG
TTTGTTGAAGCATTTGTGAAAGACCAGAGCTTGTTCTTCAAAGAGTTTACAGCTTCAATGTTGAAACTTGGAAATTTAAGAGGCTCTAGAAATGGAGAAGTGAGACTTAATTGCAGGATT
GTGAATTGA

Retrieve as FASTA