Entry information : PpaAPx-R (Pp1s277_34V6.1 / PP00277G00190 / PP00277G00200)
Entry ID 5761
Creation 2010-02-10 (Christophe Dunand)
Last sequence changes 2011-07-03 (Qiang Li)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2012-03-12 (Nizar Fawal)
Peroxidase information: PpaAPx-R (Pp1s277_34V6.1 / PP00277G00190 / PP00277G00200)
Name (synonym) PpaAPx-R (Pp1s277_34V6.1 / PP00277G00190 / PP00277G00200)
Class Ascorbate peroxidase related    [Orthogroup: APx-R001]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type Gamete
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaAPx-R
start..stop
S start..stop
VvAPx-R 332 1e-113 12..352 9..327
MdAPx-R 330 9e-113 9..352 6..320
CsAPx-R 328 6e-112 7..352 2..332
CclAPx-R 327 1e-111 9..352 4..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 197755..197905 151 N° 2 197353..197433 81 N° 3 196561..196672 112 N° 4 196213..196340 128
N° 5 195927..195997 71 N° 6 195448..195490 43 N° 7 195204..195300 97 N° 8 194864..194947 84
N° 9 194627..194748 122 N° 10 194436..194511 76 N° 11 194117..194225 109  
complement(join(194117..194225,194436..194511,194627..194748,194864..194947,1952 04..195300,195448..195490,195927..195997,196213..196340,196561..196672,197353..1 97433,197755..197905))


exon

Literature and cross-references PpaAPx-R (Pp1s277_34V6.1 / PP00277G00190 / PP00277G00200)
Literature Kuroki,Y., Toyoda,A., Sakaki,Y., Tanahashi,T., Nishiyama,T., Hiwatashi,Y., Suzuki,Y., Sugano,S., Fujiyama,A. and Hasebe,M. Evolution of developmental genes in land plants.
DNA ref. Phytozome 12:   scaffold_277 (197905..194117)
mRNA ref. JGI transcript:   95278 [5' end]   148437 [3' end]
EST ref. GenBank:   BY946235.1 [5' end]   DC949475.1 [3' end]
Cluster/Prediction ref. UniGene:   Ppa.8172
Protein sequence: PpaAPx-R (Pp1s277_34V6.1 / PP00277G00190 / PP00277G00200)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   357
PWM (Da):   %s   38379.44  
PI (pH):   %s   6.51
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALSCGSISTSSSLCCLSPIACTPPASLACHFPLRGGYLQLESRHLASSLGFRNRKLSANCYGSGIRASLDNSSPGPDEDKNVSRRQALLAVLAFTIPGSQVFQPQRFPQALAVEDEQMKIELIQRELKKVLSKGKSAGVLRLSFHDAGTFDSSDNGGMNGSLLFELERPESAGLQRPIVLQKAKKEIELAFPVSWADLIAVAGAAAVLECDGPVIPVRLGRLDASGPDPEGKMPEETLTASELKRTFQSKGFSTQEMVALSGAHTIGNKGFGNPNLFDNSYFQILLQKPWKIGPDDGMTSMIGLATDRALADDEECLEWVRVYAADQGRFFTDFSAVYTKLVNTGARWTPPQA

Retrieve as FASTA  
Remarks Complete sequence from genomic (10 introns) and 7 ESTs. Strain="Gransden2004".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACTCAGTTGCGGCTCTATCTCAACCTCCTCCTCTCTCTGCTGCCTTTCTCCCATCGCTTGTACTCCTCCCGCATCCCTCGCCTGCCATTTCCCTCTCCGCGGGGGATATCTTCAG
CTAGAATCACGTCATCTAGCTTCTAGTCTTG
GTAATTCCTCCGCCCAGCTCTCGTTTAGTGGTTCGCTAATTTCGGTGTCTGTTTCTTTTCTTTTTTTTCGTTTTTAGGTGTTGGGTCTG
TGGTGCTGGATTTTTGGGTTCCAATGTTGTTGTGGGTTCATGTGGGTTTGTAGCTATGGGACTTGAGCCCACGTTTGGATTTTACAACTGGGTTCCTGAATCCTGAGGTTTTGGTATGGA
TTTCGACGGTATTTACTGATTGCCCTGTTAGTAGTTGAATTTTTTAGAAATATATTTCTTGTCTTCGAATTGTAGTTGTTGAATTCTTGATCAAGAGCAGGTGGGTCGTCAGGTTTCAGG
AATAGGAAGTTGTCTGCGAATTGTTATGGTTCTGGTATCCGAGCATCATTGGACAATTCTTCTCCAGGGCCAG
GTACTGCTTATTCCTAATATTTTTGTCTGTTATCACTCGAGAACTAC
CTTGACATTGCCTGTCTAAGGACATTTATTCATGGGAATCTCAATGCGGTTGTTTATCCCATGAAGTTGCTTGGATTCATTGCTGCCACCACCGTACATTTACTTTCCACGCAAATTGCT
GAACGTAGCTTGTTCTTTCCATAAATTGCCTAGGACTTGTTCTCACACACTTAATCAAAGTGGGAATTGCTGGTTGCTGTTAAAATTCTGCACTTGTCTTGCCAACTCAATAGTGAAATA
ACAAGAGATAGTTGTTGTATATGAGAGAATATTGTACATCAATATCTGGTGTTTCTTGTGTTGTAAACACAAAGAACCACAGATTAGTTGTCTCAATATTCATCGTTAGTGGAATCATAT
ATCCAACCTAGGAATTCAAGAATCCAAGTTGACGTTGCTAGCTGGCCCTTAACTGATATTCCAGTTGAAGCAAGCCTTTATATATTAGAAGTATAAAAGTTGGGATTTTGTTGCTACAGC
CTTAGCGTGAGTCCTTCTAAGAAGAATTTTTGTGTTTTCCATCACATGTGGGTGGTTGTTGTAGTTCCATGGAACTCCATGCGTACCTGATTAGATTTTATTTTGCACTTAACAGTTGAG
TTTCGATTTGTTGAGAATCTCCATATTTTACAGATGAAGATAAGAATGTTTCAAGAAGACAAGCATTGCTGGCAGTGTTGGCTTTTACAATCCCAGGTTCCCAAGTATTTCAGCCACAAA
GGTTTCCTCAAGCTTTAGCTGTTGA
GTATGTTACCTTAACCTACTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTACAAGATTGAATCTCTTTTTGTTGGGCGTCTGCAC
TGCTGTCTCAATTGGGTGCAACCTGTCTCGCAATTGCTACTTACTCAGGACTTGTTTTGATTCGAGGTGGGGATCATCCATCTCTGAATGACTCTTCTCACGGGGGCTCACGTTGGTTTG
GCCAGAGATGAGCAGATGAAAATTGAGCTAATTCAACGGGAACTGAAGAAGGTGTTGTCTAAGGGGAAATCAGCCGGAGTTTTGCGATTGTCTTTCCATGATGCAGGAACGTTTGACAGC
TCTGACAACTCAG
GTAAAGCACGGTGTTCACCGTGAACTATCTCATTGGTGCCGCCGTAGAATTCTGAAATTAGTTAAGTTCGCTGAACTTTTAAAGATGAGAAGAAATCTCCAACATAA
ATTGGTTGATTCCCTTGGTAATCATTGACGCAGTATTGTTCGCTCTGGTGTAATAGCGACTATGCCAATAAGTGCTGAAATGTCATTTTCTGGTGCTTGCTGTTGCAGGAGGGATGAATG
GTTCCTTGCTTTTTGAGCTGGAAAGGCCTGAGAGTGCAGGTCTTCAGCGACCAATTAAG
GTCTCAATTCCGAAATCCTTTACTTTTTTAACGCACTCTGGATTTTATTAAGCAGATCGTT
GAAACCATTGCTGTACTTGGACTAAACCTTTTGATAATCCACATGGTTCTGATTATCATAATCCTAAATTGGTGTCTTGAAAACAGAGTAAAAGCCATGTACCAGTTTCCCTGTGTGGTT
TACGTGCTTCAATTTTTTTTTATTAGTATGTATCGCCTCAAGTCTTTTGTGTAGTACCTATCCTTCTGTCTTTCGGTGATCTCTAAAAGAGTGGAACGATGCGGAGAAGGTTGGCTTGGC
TCCTGCGCATGGATGTCAGATACCAATTGAGAAACGGCCCAAATTAGGACTTCGTGATTTTGGGTCTGTTTCAGAGTTGTCGTTACTTAATTATGTTGGCACAACATCAAAGTATATATT
CTTCTACATGTGCAGGTGTTGCAGAAAGCAAAAAAGGAGATTGAGTTAGCCTTTCCAGGTATCTCTCCTGCGCTTCGCTCTGTTTTCACTAACGACGCTAGATTCATACGCTTTCATGGC
TATAGAAACGCTCTTGTTGAGCTACATACTTAGGAAAAGGTTATCACCTACCTGATTTAGCTTGTAAATGTTGAAATATTGGCAGTGTCTTGGGCCGATTTGATTGCTGTGGCTGGAGCT
GCGGCTGTTTTGGAATGTGACGGTCCTGTGATTCCCGTTAGACTTGGCCGACTTGATGCATC
GTAAGGTTTTTCTTTAATATTTTGTTAACGATCTCGGATTCTTTGTACTCCAATGGTT
ATCTTTGAGGGTGCATATCTTCTTTTGGTGGCAGGTCTTGTGTCGTACTATGAAGTTCTTGCACTGTGTGGGATGCTTTAGGGATTAAATGGGAACTTGGTCGTAATGTCGACAGGGCTT
CTTGAGTCTCATTTGTTCAGATCAATGCACACATATTGAGGACCGACTTGACACGATTTTTTTGTTTTTTTTCTACAGTGGGCCCGACCCAGAGGGAAAGATGCCTGAAGAGACACTTAC
TGCAAGTGAACTTAAGCGAACTTTTCAATCGAAGGGTTTCTC
GTAAGTACCGTACATAAATGTATCTCATCGGCAATTTTGTTATACCAAAGATGAGAAAAGTATTTTTTTTCATGCATC
GAGGCGACGTTCCTTAAATTTTCATGTTTGGATGTAGTACTCAGGAGATGGTAGCGTTGTCTGGAGCGCATACAATAGGAAATAAGGGATTTGGGAACCCCAACCTTTTTGATAATTCCT
ATTTCCAAATTCTGCTACAAAAACCTTGGAAAATTGGAG
GTATGCAATTGTGTACCCAAAGTCCCTGATTCCATCAGGTGGTTTTGTGAACCTTATGCTGGTTAGGTTTGTCATATGCTC
TCGTGACAGGAATATCTATGGATTATGTGTTCAGGGCCAGACGATGGGATGACATCTATGATAGGATTAGCCACAGATCGTGCGCTTGCTGACGACGAGGAGTGCCTGGAGTAAGTTTCG
ACAAATATCTTCTGCTACTAATGAGTTATTGCAGTTTGAATATTAAATCAATCTCAAGTGTCGGTCCTACTATGTTGAAGGAACTTTCAGCTTGTAAATCATCGCAAAGTATTACGTGGA
CGCTTGCCTCGCTAGATTGTGTTTTATATTGTTTTATTGTTTGCATGATTCTGATGGTCCGGCGCTGCTAATTCGTGCAGGTGGGTGCGTGTGTACGCAGCTGACCAAGGGCGCTTTTTC
ACCGATTTTTCAGCTGTTTACACCAAACTAGTGAACACTGGTGCTCGTTGGACCCCTCCGCAAGCCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACTCAGTTGCGGCTCTATCTCAACCTCCTCCTCTCTCTGCTGCCTTTCTCCCATCGCTTGTACTCCTCCCGCATCCCTCGCCTGCCATTTCCCTCTCCGCGGGGGATATCTTCAG
CTAGAATCACGTCATCTAGCTTCTAGTCTTG
GTTTCAGGAATAGGAAGTTGTCTGCGAATTGTTATGGTTCTGGTATCCGAGCATCATTGGACAATTCTTCTCCAGGGCCAGATGAAGAT
AAGAATGTTTCAAGAAGACAAGCATTGCTGGCAGTGTTGGCTTTTACAATCCCAGGTTCCCAAGTATTTCAGCCACAAAGGTTTCCTCAAGCTTTAGCTGTTGA
AGATGAGCAGATGAAA
ATTGAGCTAATTCAACGGGAACTGAAGAAGGTGTTGTCTAAGGGGAAATCAGCCGGAGTTTTGCGATTGTCTTTCCATGATGCAGGAACGTTTGACAGCTCTGACAACTCAG
GAGGGATG
AATGGTTCCTTGCTTTTTGAGCTGGAAAGGCCTGAGAGTGCAGGTCTTCAGCGACCAATTAAG
GTGTTGCAGAAAGCAAAAAAGGAGATTGAGTTAGCCTTTCCAGTGTCTTGGGCCGAT
TTGATTGCTGTGGCTGGAGCTGCGGCTGTTTTGGAATGTGACGGTCCTGTGATTCCCGTTAGACTTGGCCGACTTGATGCATC
TGGGCCCGACCCAGAGGGAAAGATGCCTGAAGAGACA
CTTACTGCAAGTGAACTTAAGCGAACTTTTCAATCGAAGGGTTTCTC
TACTCAGGAGATGGTAGCGTTGTCTGGAGCGCATACAATAGGAAATAAGGGATTTGGGAACCCCAACCTTTTT
GATAATTCCTATTTCCAAATTCTGCTACAAAAACCTTGGAAAATTGGAG
GGCCAGACGATGGGATGACATCTATGATAGGATTAGCCACAGATCGTGCGCTTGCTGACGACGAGGAGTGC
CTGGA
GTGGGTGCGTGTGTACGCAGCTGACCAAGGGCGCTTTTTCACCGATTTTTCAGCTGTTTACACCAAACTAGTGAACACTGGTGCTCGTTGGACCCCTCCGCAAGCCTAG

Retrieve as FASTA