Entry information : GmPrx78 (Glyma12g33940.1)
Entry ID 577
Creation 2006-08-07 (Christophe Dunand)
Last sequence changes 2011-10-12 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-12-13 (Qiang Li)
Peroxidase information: GmPrx78 (Glyma12g33940.1)
Name (synonym) GmPrx78 (Glyma12g33940.1)
Class Class III peroxidase     [Orthogroup: Prx018]*
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type Seedlings
Inducer Salicylic acid treatment
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx78
start..stop
S start..stop
GmPrx89 492 2e-177 1..315 1..319
GmPrx34 478 4e-172 1..315 1..319
VvPrx20 471 3e-169 10..315 8..317
MtPrx57 468 5e-168 1..315 1..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 37128883..37129098 216 N° 2 37129883..37130074 192 N° 3 37131574..37132110 537  
join(37128883..37129098,37129883..37130074,37131574..37132110)


exon

Literature and cross-references GmPrx78 (Glyma12g33940.1)
Literature Tian,A.G., et al, Characterization of soybean genomic features by analysis of its expressed sequence tags.
DNA ref. Phytozome 12:   Gm12 (37128883..37132110)
Protein sequence: GmPrx78 (Glyma12g33940.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   315 (290)
PWM (Da):   %s   33796.99 (31090.5)  
PI (pH):   %s   5.85 (5.36) Peptide Signal:   %s   cut: 26 range:26-315
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPLLRTLFFVALSILSLLACFTNAQLSTNFYDKTCPNLQTIVKNAMQQAINGEARLGASILRLFFHDCFVNGCDASILLDDTATFVGEKNALPNRNSVRGYEVIDTIKTNVEAACNGTVSCADILALAARDGVVLVGGPSWAVALGRRDARTASESAANNEIPSPFLDLPTLVSMFAAKGLSARDLTVLSGGHTIGQAQCQFFRSRIYNETNIDPNFAASRRAICPASAGDTNLSPLESLTPNRFDNSYYSELAAKRGLLNSDQVLFNDPLVTTYSTNNAAFFTDFADAMVKMSNISPLTGTSGEIRRNCRVLN

Retrieve as FASTA  
Remarks Complete sequence from genomic and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCCCCTTGTTACGTACCCTCTTCTTTGTTGCACTCTCCATTCTTTCTCTCCTTGCTTGTTTTACCAATGCACAACTTTCTACCAACTTTTATGATAAAACTTGTCCTAACCTTCAA
ACCATTGTGAAAAATGCAATGCAGCAAGCTATCAATGGAGAAGCCAGGCTTGGAGCCTCTATACTTCGATTGTTCTTCCACGACTGTTTCGTGAAC
GTAAGACTGCAGTTCCTTAAGCCA
CTTCTATTTCTAAATCTGTATGTTTATAATTACATGTAAGGAGTGTATCATGTGAGAGAGTGAACAAATTAAGCTAACTTTTCACTACTCAAAGTTATAAGAGAATAATTAAGATTAAAT
TTAAACCAAATTAATAGTATAGTTATTCAGTATGTTTTATGTATTTATGGTTAAGATTAGTTCTTCTAACACTCACTTGATACATTTATAAAAAAGAATCACTCACTTGATATACGTACA
TTGTATATGCCTATATGGCTGCTTAAAGCAAAAAATTACACGTTTTAGCTAGGTTTAAGTTTATGGCTTTTGAAGGAGCCAAAAAATACTATAGTACTGTAACTACTTGAATAAGCCATC
GAATGAAAATATTTGTCTTTTATTTATTTTTTTTCTCTAAGAAAAAGCACATGGATATTATCATATTTTCTAACACTAACTATTTAATACAGTATTTTTGTTTTGCATACACATTTTTTC
TCAGATCTAGAGGAAATATACACGCATGATGAATCATTTGTATAAGATTTTTTTTTATTCTGATTTTTTTAAGAATAGGACGCCTCCCGATGTAAGAATTAAATTGATGCAAATCTTACC
AAAGGAATTGAAAGAAAGTAAAATAAATGGTATGAAAGTATCATTTATTTTCTAAAAATAAATTTCATTGGCAAGAATTAATTTAGTTATATAGCTCTTGACTTATGGAGATAGATAACA
TTAACATCTTGATTTTATTTCTTTGTAATTAAATTATCAGGGCTGCGATGCATCAATCTTATTGGATGACACTGCCACGTTTGTGGGTGAGAAAAATGCATTACCTAACCGAAATTCAGT
GAGGGGTTACGAAGTGATTGACACCATTAAAACCAACGTTGAAGCTGCTTGCAATGGCACGGTCTCTTGTGCAGATATTCTAGCACTTGCAGCAAGAGATGGAGTAGTTCTG
GTGAGCCA
TCCTTTTCCCCTTTCTTTGTGTGTATATGATTTCATTTTTATTTGGCAGCCTCTAGCTTCTACCAAATCTATTACTACTATGTTATATATATATATATGAATTCATTTTTATTTGACCCA
TTACATATACGTAGTATAATTCTTTTCACCTATATATGTACGTATATGGGATCTGAAAAATGGGTCAAATTTCCTTGACTTGGAAAGTTGATTTCAGGTCATAAAAGGAAATATGCAAAA
AATTCCAAGTTTTTAATTTCACTTTAATATCTGTACATAATTTTTCGAATAAACATCTTATTTTATTAAATGTATGTTGTTAAAAATAAAAAGAAAGAAAATACAAGGGAAATAACTTGA
AACCTGTCAAATGACTGTCCTTAATTAAGATTATTTTTCTCTATTCTCTACCTGAAATCTCCAACATTACATTCAATGTACCCCAATTACATGAGTAAATATAGGTAATTAAATAATTGT
ATAAAAAAATATGTGAAAAATGTAAACTCTTTTAGGTTTTTTCCTGCTCCCGTTGAGAATTGCATTGAAATCATACAGCGAGATTCCAACCTACAGTCATTCTCTCAAGCATATAGCTAA
GCTAACTTGATGTCTGTTTTTTTCCTAACATATTTTGGCATGGGCTTATTTTCAAACCTTGTTCTCCACTTTCGGTTTTTACTTTTCCCTCTCACACGTAATGGATCACCATGTCAACTC
TCGTAATTTAGTGGGGTCCCCCTCCTCTTAATAAGCATGCCTTGCACAAAAAATTACATCACACAAAGCAATAATCAAGAAAAGAAAAATAAAATAAAAACTATGGTGTCAGCCTTGTCT
CATTCTCGAGAAAAACCACTCATCTTCCCCTTTTAAAAATCTCGAAAACAAAAGTACCATCAAACCTTTGTCTCGTGGTGAGTTTTCCATATTTAGCTTTCGCTCACCACTCCCTAACTC
AATAATTCACCATCATTTAAGTATCTGTTTGGTTTGATATTGAATAATCTAAAATCACCTTAAAATAGAAGTTGTAGTATTCATACAATCATAAATAGAATATTTTATATGATAAAAAAA
TTGTTTATTTTCCTTTACTGTATTATTTATTAATTTTGTAGTTCTCTTTTCTCTCTCTTTATTGCCTAACTTGTTGTATTTTGATTTATAACTACCATTAATTTGATTTGTTATGTAATC
TGTTATATGAGTTGATGTACGAATAAAATTTCTCTTAAAATACCAAAGAACATAATTTTAAGTAAATATTCATATATTTAACGAGTGTTTGGTAACATGTTGGAAATCCACATTGTGAAA
TCAATATATAAAAGCAGAAATTTTTTAATCCAGAAAACCAGGTTGAGGGCAAATGAACATGATACCAAACACACTTCATAAAAATATTAAAATTTCAACATGGTACCAAACAGATTTCAG
AAATAAATACTTAAGTGTGTTAATTGAAACATTGAATAATTTGATTGACAGGTTGGAGGACCTTCATGGGCAGTAGCACTAGGCAGAAGGGATGCAAGAACAGCAAGCGAGAGTGCAGCC
AACAACGAAATCCCTTCACCATTCTTGGACCTTCCCACACTCGTGTCCATGTTCGCCGCCAAAGGGTTAAGCGCACGTGACCTCACGGTGCTCTCCGGTGGCCACACCATAGGCCAAGCA
CAGTGCCAATTTTTCAGAAGTCGCATATACAACGAGACCAACATTGACCCCAACTTTGCCGCATCAAGAAGAGCCATTTGCCCTGCCTCTGCTGGGGACACCAACTTGTCCCCTCTTGAG
TCTCTCACTCCCAATCGCTTTGACAACAGCTACTACTCTGAGCTTGCGGCTAAGCGTGGCCTTCTCAACTCGGACCAAGTGCTTTTCAATGACCCTTTGGTCACAACATATAGTACCAAT
AATGCTGCATTTTTCACTGACTTTGCTGATGCTATGGTTAAGATGAGCAATATTAGTCCTCTCACTGGGACTAGTGGTGAGATTCGAAGGAATTGCAGAGTTCTGAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCCCCTTGTTACGTACCCTCTTCTTTGTTGCACTCTCCATTCTTTCTCTCCTTGCTTGTTTTACCAATGCACAACTTTCTACCAACTTTTATGATAAAACTTGTCCTAACCTTCAA
ACCATTGTGAAAAATGCAATGCAGCAAGCTATCAATGGAGAAGCCAGGCTTGGAGCCTCTATACTTCGATTGTTCTTCCACGACTGTTTCGTGAAC
GGCTGCGATGCATCAATCTTATTG
GATGACACTGCCACGTTTGTGGGTGAGAAAAATGCATTACCTAACCGAAATTCAGTGAGGGGTTACGAAGTGATTGACACCATTAAAACCAACGTTGAAGCTGCTTGCAATGGCACGGTC
TCTTGTGCAGATATTCTAGCACTTGCAGCAAGAGATGGAGTAGTTCTG
GTTGGAGGACCTTCATGGGCAGTAGCACTAGGCAGAAGGGATGCAAGAACAGCAAGCGAGAGTGCAGCCAAC
AACGAAATCCCTTCACCATTCTTGGACCTTCCCACACTCGTGTCCATGTTCGCCGCCAAAGGGTTAAGCGCACGTGACCTCACGGTGCTCTCCGGTGGCCACACCATAGGCCAAGCACAG
TGCCAATTTTTCAGAAGTCGCATATACAACGAGACCAACATTGACCCCAACTTTGCCGCATCAAGAAGAGCCATTTGCCCTGCCTCTGCTGGGGACACCAACTTGTCCCCTCTTGAGTCT
CTCACTCCCAATCGCTTTGACAACAGCTACTACTCTGAGCTTGCGGCTAAGCGTGGCCTTCTCAACTCGGACCAAGTGCTTTTCAATGACCCTTTGGTCACAACATATAGTACCAATAAT
GCTGCATTTTTCACTGACTTTGCTGATGCTATGGTTAAGATGAGCAATATTAGTCCTCTCACTGGGACTAGTGGTGAGATTCGAAGGAATTGCAGAGTTCTGAAT

Retrieve as FASTA