Entry information : HaPrx13 (HanXRQChr10g0296251)
Entry ID 5792
Creation 2007-09-06 (Christophe Dunand)
Last sequence changes 2017-11-28 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-29 (Christophe Dunand)
Peroxidase information: HaPrx13 (HanXRQChr10g0296251)
Name (synonym) HaPrx13 (HanXRQChr10g0296251)
Class Class III peroxidase    [Orthogroup: Prx104]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx13
start..stop
S start..stop
HaPrx21 577 0 1..331 43..376
HaPrx[P]76 566 0 1..331 1..334
HaPrx20 528 0 1..331 1..330
LsaPrx11 526 0 36..331 33..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 117739634..117740056 423 N° 2 117739390..117739552 163 N° 3 117738894..117739303 410  
complement(join(117738894..117739303,117739390..117739552,117739634..117740056))


exon

Literature and cross-references HaPrx13 (HanXRQChr10g0296251)
Literature Michelmore,R.W., Knapp,S., Rieseberg,L., Bradford,K., Kesseli,R., Boore,J., Kozik,A., Matvienko,M., Lavelle,D. and Lai,Z. Sunflower (Helianthus annuus) ESTs (set 2) from the Compositae.
DNA ref. HanXRQ genome:   HanXRQChr10 (117740056..117738894)
EST ref. GenBank:   DY919693 [5' end]
Cluster/Prediction ref. HanXRQ:   HanXRQChr10g0296251
Protein sequence: HaPrx13 (HanXRQChr10g0296251)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325
PWM (Da):   %s   34360.31  
PI (pH):   %s   7.27
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGFSSLNKTVALLVLLLATFTTLSLGQGNRGGGGGTQVGFYSSTCPRVESIVRSAVESAVQANPTIAPGLLRMFFHDCFINGCDASILIDGPTTEKSAGPNSLLRGFEVIDAAKSQLETTCPGVVSCADIVALAARDSVVLTGGHSWQVRLGRRDGLVSQASDTANLPAFNDPIGVQISKFADKGLNTQDLVTLVGGHTIGTAACSLFSYRLYNFNNTNGPDPDINPAFLPLLRALCPNGGDGSRRVALDTSSENSFGSSFYENLRNGRGVIESDAKLWSDQRTQRYVQGFLGQSGSRFNAEFGRAMVKMGNIEVKTGRQGEIRRVCTATN

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGTTTTCTTCCCTAAACAAAACAGTTGCCTTGTTGGTTCTTCTCTTAGCCACATTTACAACCTTGTCACTAGGCCAAGGCAATCGTGGTGGTGGAGGAGGCACTCAAGTTGGCTTC
TACAGCTCAACCTGCCCTCGCGTGGAGTCCATAGTCCGGTCAGCAGTTGAGTCTGCGGTCCAAGCCAACCCAACAATCGCACCTGGTTTATTAAGAATGTTCTTCCATGACTGCTTTATC
AATGGTTGTGATGCATCTATACTAATTGACGGACCCACAACCGAGAAGTCAGCAGGCCCAAACTCTCTCTTGAGAGGCTTTGAAGTTATTGATGCTGCAAAGTCCCAGCTCGAAACCACC
TGCCCTGGAGTGGTCTCATGTGCTGATATTGTTGCCCTAGCTGCCCGAGATTCTGTAGTCCTG
GTAACTAGATGTTTATTTAACAACTTGTAGTTATAAGCTTAACTAGTCATGGTCGTT
AATCATTTTTGTGACATGTTGCAGACCGGTGGACATAGTTGGCAGGTACGATTAGGACGTAGAGATGGATTGGTTTCACAAGCATCGGATACTGCAAACTTACCTGCCTTTAATGACCCT
ATTGGTGTCCAAATCAGTAAATTTGCTGATAAAGGCCTCAACACCCAAGATCTTGTTACACTTGTGG
GTAAGTAGAATAAAGTAATGTAGAAAAACTGCTAATGTATAGAATGTTATAGC
CTTATTTATAATTTTTGTTTTTTTGTTTCCCAGGTGGACACACAATTGGAACAGCAGCCTGTTCATTATTCAGCTACAGGTTATACAACTTCAACAATACCAATGGACCCGACCCTGATA
TAAACCCAGCATTCCTACCACTGCTCCGAGCACTTTGCCCCAATGGTGGTGATGGGTCAAGGCGTGTGGCCCTTGATACAAGTAGCGAAAATAGTTTCGGCAGTTCATTCTATGAAAACT
TGAGGAATGGGCGTGGAGTTATTGAGTCCGATGCAAAACTATGGAGCGACCAGAGGACTCAGAGGTATGTACAAGGGTTCCTGGGACAATCTGGATCCAGATTCAACGCGGAGTTTGGAA
GAGCAATGGTAAAGATGGGTAACATTGAGGTGAAAACAGGGAGACAAGGTGAAATTCGTAGGGTTTGTACCGCAACAAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGTTTTCTTCCCTAAACAAAACAGTTGCCTTGTTGGTTCTTCTCTTAGCCACATTTACAACCTTGTCACTAGGCCAAGGCAATCGTGGTGGTGGAGGAGGCACTCAAGTTGGCTTC
TACAGCTCAACCTGCCCTCGCGTGGAGTCCATAGTCCGGTCAGCAGTTGAGTCTGCGGTCCAAGCCAACCCAACAATCGCACCTGGTTTATTAAGAATGTTCTTCCATGACTGCTTTATC
AATGGTTGTGATGCATCTATACTAATTGACGGACCCACAACCGAGAAGTCAGCAGGCCCAAACTCTCTCTTGAGAGGCTTTGAAGTTATTGATGCTGCAAAGTCCCAGCTCGAAACCACC
TGCCCTGGAGTGGTCTCATGTGCTGATATTGTTGCCCTAGCTGCCCGAGATTCTGTAGTCCTG
ACCGGTGGACATAGTTGGCAGGTACGATTAGGACGTAGAGATGGATTGGTTTCACAA
GCATCGGATACTGCAAACTTACCTGCCTTTAATGACCCTATTGGTGTCCAAATCAGTAAATTTGCTGATAAAGGCCTCAACACCCAAGATCTTGTTACACTTGTGG
GTGGACACACAATT
GGAACAGCAGCCTGTTCATTATTCAGCTACAGGTTATACAACTTCAACAATACCAATGGACCCGACCCTGATATAAACCCAGCATTCCTACCACTGCTCCGAGCACTTTGCCCCAATGGT
GGTGATGGGTCAAGGCGTGTGGCCCTTGATACAAGTAGCGAAAATAGTTTCGGCAGTTCATTCTATGAAAACTTGAGGAATGGGCGTGGAGTTATTGAGTCCGATGCAAAACTATGGAGC
GACCAGAGGACTCAGAGGTATGTACAAGGGTTCCTGGGACAATCTGGATCCAGATTCAACGCGGAGTTTGGAAGAGCAATGGTAAAGATGGGTAACATTGAGGTGAAAACAGGGAGACAA
GGTGAAATTCGTAGGGTTTGTACCGCAACAAATTGA

Retrieve as FASTA