Entry information : TatCP01
Entry ID 5797
Creation 2007-09-17 (Marcel Zamocky)
Last sequence changes 2011-05-18 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: TatCP01
Name TatCP01
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Hypocreaceae Trichoderma
Organism Trichoderma atroviride    [TaxId: 63577 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TatCP01
start..stop
S start..stop
TaspCP02 1417 0 1..761 1..762
TharCP01 1323 0 1..757 1..759
TviCP01 1321 0 1..757 1..756
HjCP01 1318 0 6..757 5..757
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 332893..333591 699 N° 2 333649..335235 1587  
join(332893..333591,333649..335235)


exon

Literature and cross-references TatCP01
Literature Kubicek, C.P., Baker, S.E., Gamauf, C., Kenerley, C.P. and Druzhinina, I.S. Purifying selection and birth-and-death evolution in the class II hydrophobin gene families of the ascomyceteous genus Trichoderma/Hypocrea (Unpublished July 2007)
DNA ref. JGI genome:   contig_29 (332893..335235)
Protein sequence: TatCP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   761
PWM (Da):   %s   82970.99  
PI (pH):   %s   6.69
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGDAGKCPVNHINAAGGGTRNKDWWPESLKLNILRQHTNVTNPLGDDFDYAAAFKTLDYDAVKKDLTALMTDSQDFWPADFGHYGGLFVRLAWHSTGTYRVFDGRGGGAQGQQRFAPLNSWPDNVSLDKARRLLWPIKAKYGNKLSWADLIVLSGNVALESMGFKTIGFAGGRSDTWEADEAAYWGGETTWLGNDVRYAHGFAGASKDHGVVDSDERKHTDVHSRELEAPLGAAHMGLIYVNPEGPDGNADALAAARDIRITFARMAMNDEETVALIAGGHTFGKTHGAGPSSHVGPEPAGAPLENQGLGWVSTFGSGKGADTITSGLEVTWTKTPTKWSNQFFEYLFKYEWELTKSPAGAKQWVAKNAEPFIPHAFDPNKKLLPTMLTTDLSLRVDPAYEKISRRFLENPDQFAEVFAKAWFKLTHRDMGPSTRYVGPEIPKEQFSWQDPIPAVNYTLINDSDVAALKKEVLASGVTPSKLISTAWASASTFRGSDKRGGANGARIRLAPQKDWEANNPAQLAEVLQALEKVQQKFNSSQSGGKKVSLADLIVLAGSAAIEKAAKDAGHDITVPFTPGRNDATQEQTDVESVGHLEPVADGFRNYGKSTQRVKLEHLLVDKAHLLTLSVPELTVLIGGLRVLNTNYDGSTHGVFTNQPGVLTNDFFVNLLDMGTVWKPNPSNGDLFEGSDRKSGAKKWTATRVDLVLGSHPELRAVAEVYGSSDSKQKFVKDFVAAWTKVANLDRFDLPRESLLRPTSRL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron). Strain="IMI 206040".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCGACGCCGGAAAGTGTCCCGTAAACCACATCAACGCCGCTGGCGGTGGCACTCGAAATAAGGATTGGTGGCCCGAATCACTCAAACTGAACATTCTTCGTCAGCACACAAACGTG
ACCAACCCCCTGGGTGATGACTTTGACTATGCGGCCGCTTTCAAAACCCTTGACTATGATGCCGTCAAGAAGGACTTGACGGCCCTGATGACCGATAGTCAAGACTTTTGGCCCGCCGAT
TTTGGCCATTATGGAGGTCTGTTTGTTCGTCTGGCCTGGCATTCCACTGGTACCTATAGAGTCTTTGACGGCCGCGGCGGAGGAGCACAAGGCCAACAACGATTCGCGCCTCTCAACAGC
TGGCCCGACAACGTGAGCTTGGACAAGGCCCGACGTCTTCTTTGGCCCATCAAGGCAAAGTATGGCAACAAGCTCTCATGGGCTGATCTCATTGTCCTGTCCGGCAACGTGGCCCTTGAA
TCCATGGGTTTCAAGACCATAGGCTTCGCAGGTGGCCGCTCAGACACTTGGGAGGCTGACGAGGCCGCCTATTGGGGTGGCGAAACTACATGGCTGGGCAACGATGTCCGATATGCCCAC
GGTTTCGCGGGAGCTTCCAAAGATCATGGAGTTGTCGACTCCGACGAGAGGAAGCACACTGATGTCCACTCTCGCGAGCTCGAGGCCCCCCTAGGAGCA
GTACGTATCTTTGCTTTCAGA
CATTCTTCAAAGACTAGATTTGCTAATGCAAAATAGGCACACATGGGACTTATCTACGTCAACCCAGAGGGCCCTGATGGCAACGCTGATGCTCTTGCGGCGGCCCGTGATATTCGCATC
ACCTTTGCCCGTATGGCGATGAACGATGAAGAGACGGTGGCTTTGATTGCCGGTGGCCACACCTTTGGCAAAACCCACGGCGCAGGCCCTTCAAGCCACGTAGGCCCTGAGCCTGCGGGC
GCACCTCTTGAGAACCAGGGTCTTGGTTGGGTCAGCACTTTTGGCTCTGGAAAGGGCGCTGATACCATCACCAGTGGCCTCGAGGTGACCTGGACCAAGACGCCGACCAAGTGGAGCAAC
CAGTTCTTCGAATATCTCTTCAAGTACGAATGGGAGCTGACAAAGAGCCCTGCTGGAGCAAAGCAGTGGGTGGCAAAGAACGCCGAGCCGTTTATTCCGCACGCTTTCGATCCTAACAAG
AAGCTGCTGCCCACTATGCTGACCACAGACTTGTCGCTCCGTGTCGACCCGGCTTACGAGAAGATCTCTCGCCGCTTCTTGGAGAACCCCGATCAGTTCGCGGAAGTGTTTGCCAAGGCC
TGGTTCAAGCTGACGCATCGTGACATGGGACCATCCACCCGCTACGTGGGCCCCGAGATCCCCAAGGAACAGTTCTCTTGGCAGGATCCTATCCCCGCCGTCAACTACACTCTGATCAAC
GACAGTGACGTCGCCGCTCTCAAGAAGGAAGTGTTGGCATCCGGGGTTACACCCTCCAAGCTGATCTCCACTGCCTGGGCATCTGCTTCAACTTTCCGTGGCAGCGACAAGCGAGGTGGT
GCCAACGGTGCCCGCATTCGCCTGGCGCCACAGAAGGACTGGGAGGCCAACAACCCTGCCCAGCTGGCCGAGGTTCTGCAGGCATTGGAGAAGGTCCAGCAGAAGTTCAACAGCTCGCAG
AGCGGTGGCAAGAAGGTATCCCTTGCCGACCTGATTGTCTTGGCGGGATCTGCGGCTATTGAGAAGGCCGCTAAGGACGCTGGACACGACATCACCGTTCCATTTACTCCTGGCCGCAAT
GATGCTACTCAGGAGCAGACTGATGTTGAGTCGGTTGGCCACCTCGAGCCTGTCGCTGATGGTTTCCGAAACTACGGCAAGTCCACGCAGAGAGTCAAGCTGGAGCACCTCTTGGTCGAC
AAGGCCCACCTCCTCACTCTCTCGGTGCCTGAACTGACAGTCCTCATTGGCGGTCTTCGTGTTCTAAACACAAACTACGACGGCTCAACTCACGGTGTCTTCACCAACCAGCCTGGTGTG
CTTACCAACGACTTCTTCGTCAACCTCCTAGATATGGGAACTGTCTGGAAGCCCAACCCCTCCAACGGTGATCTCTTTGAGGGCAGCGACCGTAAGAGCGGTGCTAAGAAGTGGACTGCA
ACCCGCGTTGACTTGGTCCTCGGCTCTCACCCTGAACTGCGGGCTGTTGCGGAAGTGTACGGCAGCTCCGATTCCAAGCAGAAGTTTGTAAAAGACTTTGTGGCTGCTTGGACAAAGGTT
GCGAACCTGGATCGCTTTGATCTTCCGAGGGAATCTCTCTTGAGGCCAACTAGCCGCTTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCGACGCCGGAAAGTGTCCCGTAAACCACATCAACGCCGCTGGCGGTGGCACTCGAAATAAGGATTGGTGGCCCGAATCACTCAAACTGAACATTCTTCGTCAGCACACAAACGTG
ACCAACCCCCTGGGTGATGACTTTGACTATGCGGCCGCTTTCAAAACCCTTGACTATGATGCCGTCAAGAAGGACTTGACGGCCCTGATGACCGATAGTCAAGACTTTTGGCCCGCCGAT
TTTGGCCATTATGGAGGTCTGTTTGTTCGTCTGGCCTGGCATTCCACTGGTACCTATAGAGTCTTTGACGGCCGCGGCGGAGGAGCACAAGGCCAACAACGATTCGCGCCTCTCAACAGC
TGGCCCGACAACGTGAGCTTGGACAAGGCCCGACGTCTTCTTTGGCCCATCAAGGCAAAGTATGGCAACAAGCTCTCATGGGCTGATCTCATTGTCCTGTCCGGCAACGTGGCCCTTGAA
TCCATGGGTTTCAAGACCATAGGCTTCGCAGGTGGCCGCTCAGACACTTGGGAGGCTGACGAGGCCGCCTATTGGGGTGGCGAAACTACATGGCTGGGCAACGATGTCCGATATGCCCAC
GGTTTCGCGGGAGCTTCCAAAGATCATGGAGTTGTCGACTCCGACGAGAGGAAGCACACTGATGTCCACTCTCGCGAGCTCGAGGCCCCCCTAGGAGCA
GCACACATGGGACTTATCTAC
GTCAACCCAGAGGGCCCTGATGGCAACGCTGATGCTCTTGCGGCGGCCCGTGATATTCGCATCACCTTTGCCCGTATGGCGATGAACGATGAAGAGACGGTGGCTTTGATTGCCGGTGGC
CACACCTTTGGCAAAACCCACGGCGCAGGCCCTTCAAGCCACGTAGGCCCTGAGCCTGCGGGCGCACCTCTTGAGAACCAGGGTCTTGGTTGGGTCAGCACTTTTGGCTCTGGAAAGGGC
GCTGATACCATCACCAGTGGCCTCGAGGTGACCTGGACCAAGACGCCGACCAAGTGGAGCAACCAGTTCTTCGAATATCTCTTCAAGTACGAATGGGAGCTGACAAAGAGCCCTGCTGGA
GCAAAGCAGTGGGTGGCAAAGAACGCCGAGCCGTTTATTCCGCACGCTTTCGATCCTAACAAGAAGCTGCTGCCCACTATGCTGACCACAGACTTGTCGCTCCGTGTCGACCCGGCTTAC
GAGAAGATCTCTCGCCGCTTCTTGGAGAACCCCGATCAGTTCGCGGAAGTGTTTGCCAAGGCCTGGTTCAAGCTGACGCATCGTGACATGGGACCATCCACCCGCTACGTGGGCCCCGAG
ATCCCCAAGGAACAGTTCTCTTGGCAGGATCCTATCCCCGCCGTCAACTACACTCTGATCAACGACAGTGACGTCGCCGCTCTCAAGAAGGAAGTGTTGGCATCCGGGGTTACACCCTCC
AAGCTGATCTCCACTGCCTGGGCATCTGCTTCAACTTTCCGTGGCAGCGACAAGCGAGGTGGTGCCAACGGTGCCCGCATTCGCCTGGCGCCACAGAAGGACTGGGAGGCCAACAACCCT
GCCCAGCTGGCCGAGGTTCTGCAGGCATTGGAGAAGGTCCAGCAGAAGTTCAACAGCTCGCAGAGCGGTGGCAAGAAGGTATCCCTTGCCGACCTGATTGTCTTGGCGGGATCTGCGGCT
ATTGAGAAGGCCGCTAAGGACGCTGGACACGACATCACCGTTCCATTTACTCCTGGCCGCAATGATGCTACTCAGGAGCAGACTGATGTTGAGTCGGTTGGCCACCTCGAGCCTGTCGCT
GATGGTTTCCGAAACTACGGCAAGTCCACGCAGAGAGTCAAGCTGGAGCACCTCTTGGTCGACAAGGCCCACCTCCTCACTCTCTCGGTGCCTGAACTGACAGTCCTCATTGGCGGTCTT
CGTGTTCTAAACACAAACTACGACGGCTCAACTCACGGTGTCTTCACCAACCAGCCTGGTGTGCTTACCAACGACTTCTTCGTCAACCTCCTAGATATGGGAACTGTCTGGAAGCCCAAC
CCCTCCAACGGTGATCTCTTTGAGGGCAGCGACCGTAAGAGCGGTGCTAAGAAGTGGACTGCAACCCGCGTTGACTTGGTCCTCGGCTCTCACCCTGAACTGCGGGCTGTTGCGGAAGTG
TACGGCAGCTCCGATTCCAAGCAGAAGTTTGTAAAAGACTTTGTGGCTGCTTGGACAAAGGTTGCGAACCTGGATCGCTTTGATCTTCCGAGGGAATCTCTCTTGAGGCCAACTAGCCGC
TTGTAA

Retrieve as FASTA