Entry information : PtritCP01
Entry ID 5798
Creation 2007-09-17 (Marcel Zamocky)
Last sequence changes 2011-05-23 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: PtritCP01
Name PtritCP01
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Pyrenophora
Organism Pyrenophora tritici-repentis    [TaxId: 45151 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtritCP01
start..stop
S start..stop
PterCP 1554 0 1..760 1..760
AalteCP01 1457 0 1..760 1..760
COsaCP 1437 0 1..760 1..761
SturCP 1436 0 1..760 1..759
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 348410..348672 263 N° 2 348728..349203 476 N° 3 349258..350801 1544  
join(348410..348672,348728..349203,349258..350801)


exon

Literature and cross-references PtritCP01
Literature Birren, B., Lander, E., Galagan, J., Nusbaum, C., Devon, K. et al. direct submission (April 2007), otherwise unpublished.
DNA ref. JGI genome:   supercontig_1.11 (348410..350801)
Protein sequence: PtritCP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   760
PWM (Da):   %s   84392.09  
PI (pH):   %s   6.48
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSQGECPVKKVPNVAGSGTRNTDWWPNELRTNILRQHDPRQNPLGPDFNYVEEFKKLDYDALKKDLNALMTDSQDWWPADFGHYGGLFIRMAWHSAGTYRVTDGRGGGGDGQQRFAPLNAWPDNVSLDKARRLLWPIKQKYGNKISWADLMLLTGNVALESMGCPTFGFAGGRADTFQSDESVYWGGETEWLGSDVRYADGAKGVKGEGIMDGDQHKTDKSEPHTSRNLEQPLAAAHMGLIYVNPGPEGIPDPVAAAHDIRTTFGRMAMNDAETAALIIGGHSFGKTHGAAPSENTGPDPNSEDLATQGFGWMNKHGRGNGPDTITSGLEVTWTGTPTKWSNKYLEYLYKFEWELEKSPAGANQWVAKTDEHIIPDAYDQNKKHKPRMLTTDLAMRMDPAYEKITRRWLEHPQELHDTFVRAWFKLLHRDMGPRSRWLGPEVPKEVLIWEDPVPQPEGELIGESDIATLKKQVLDAGVEPAKLIRTAWASAASFRGSDKRGGANGARIRLAPQKDWEVNNPKELAEVLKALEGVQSKFNSGSKKVSLADLIVLAGTAAVEKAAGVQVPFTPGRTDATQEQTDAKSFEHLEPVTDGFRNYGKGTDRVRTEQLDVDKAHLLRLTAPEMVVLTGGMRALNANWDGSSHGVFTKRPGQLTNDFFVNLLDNNLEWKAADSSKELYEGFDRKSGQKKWTATRHDLVFGHHPELRAVAETYAQADNTDKFVKDFVAGWEKIMNNDRFDIKNKSVSAQSRGANKPRL

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns). Strain="Pt-1C-BFP".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCCAAGGCGAGTGCCCAGTGAAGAAGGTACCCAACGTCGCCGGCAGTGGTACCAGGAACACCGACTGGTGGCCCAATGAGCTCAGGACAAACATTCTCCGCCAGCACGACCCCAGA
CAGAACCCTCTCGGCCCCGACTTCAACTATGTCGAAGAGTTCAAGAAGCTCGACTACGATGCCTTGAAGAAGGACCTCAATGCCTTGATGACCGACTCGCAGGACTGGTGGCCTGCTGAC
TTTGGTCATTACGGTGGTCTCTT
GTATGTCCCATACTTGGTTAGCATTGGCCATGTACCGTATCTAACTCGCGCCCAGCATCCGAATGGCATGGCACTCTGCTGGAACCTACCGTGTTAC
CGACGGTCGTGGTGGTGGCGGTGATGGACAGCAGCGCTTTGCTCCCCTCAACGCCTGGCCCGACAACGTCTCCCTCGACAAGGCTCGCCGCCTCCTCTGGCCCATCAAGCAAAAGTACGG
CAACAAGATCTCATGGGCCGACCTTATGCTCCTCACCGGCAATGTCGCCCTTGAATCCATGGGCTGTCCGACTTTCGGTTTCGCCGGTGGCCGTGCCGACACCTTCCAGTCCGACGAGTC
GGTCTACTGGGGTGGTGAGACTGAGTGGTTGGGCAGCGATGTCCGCTACGCTGATGGTGCAAAGGGTGTCAAGGGCGAGGGCATCATGGACGGCGACCAGCACAAGACTGACAAGAGCGA
ACCCCACACATCGAGGAACCTCGAACAGCCATTAGCTGCCGCACACATGGGTCTCATCTACGTGAACCCCGAAG
GTCAGTACTTCTGAGCATTCAAGTCAACCAACCGTTACTAACCCAC
GCTTCCAGGTCCCGAAGGTATACCCGACCCAGTTGCCGCCGCTCACGACATCAGAACAACCTTTGGCCGCATGGCTATGAACGACGCGGAAACCGCTGCCCTCATCATCGGTGGCCACTC
TTTCGGAAAGACCCACGGTGCTGCTCCCTCTGAGAACACCGGCCCAGACCCCAACTCCGAGGACCTCGCAACACAAGGATTTGGCTGGATGAACAAGCACGGTCGTGGCAACGGCCCAGA
CACCATCACCAGTGGACTTGAGGTCACCTGGACCGGCACACCCACCAAGTGGAGCAACAAGTACCTCGAGTACCTCTACAAGTTTGAGTGGGAGCTGGAGAAGAGCCCTGCTGGTGCCAA
CCAATGGGTTGCCAAGACCGACGAGCACATTATCCCTGATGCGTACGACCAGAACAAGAAGCACAAGCCAAGAATGTTGACCACTGATCTGGCTATGCGTATGGACCCTGCCTACGAGAA
GATCACTCGTCGCTGGTTGGAGCACCCCCAGGAGCTCCACGACACTTTTGTTCGTGCATGGTTCAAGCTTCTCCACCGTGATATGGGTCCTCGCTCCAGGTGGCTCGGTCCCGAGGTTCC
CAAGGAGGTCCTTATCTGGGAAGACCCCGTTCCTCAGCCAGAAGGCGAGCTCATCGGCGAGTCCGATATTGCGACGCTGAAGAAGCAGGTTCTCGACGCTGGCGTTGAGCCCGCCAAGCT
TATCCGCACTGCTTGGGCTTCGGCAGCTTCGTTCCGTGGTAGCGACAAGCGTGGAGGTGCTAACGGCGCCCGCATCCGCCTCGCTCCTCAAAAGGACTGGGAGGTCAACAACCCCAAGGA
GCTCGCTGAGGTCCTCAAGGCTCTTGAGGGTGTTCAGTCCAAGTTCAACAGCGGCAGCAAGAAGGTTTCCCTCGCCGACTTGATTGTACTTGCCGGTACCGCTGCTGTTGAAAAGGCCGC
CGGTGTACAAGTTCCCTTCACACCTGGCCGCACCGACGCCACACAGGAGCAGACTGATGCCAAGTCTTTCGAGCACCTTGAGCCTGTAACCGACGGTTTCCGCAACTACGGCAAGGGAAC
CGACCGTGTCCGTACTGAGCAGCTTGACGTTGACAAGGCCCACCTTCTCCGCCTCACAGCACCCGAGATGGTTGTCCTCACTGGTGGTATGCGTGCGCTGAACGCCAACTGGGACGGCTC
ATCTCACGGCGTCTTCACCAAGCGCCCCGGTCAACTCACCAACGACTTCTTCGTCAACCTCCTCGATAACAACCTCGAGTGGAAGGCGGCCGACTCTAGCAAGGAGCTCTACGAGGGTTT
CGACCGCAAGTCCGGCCAGAAGAAGTGGACAGCTACCCGCCACGACCTAGTATTTGGTCACCACCCTGAACTACGTGCGGTTGCCGAGACATACGCCCAGGCCGACAACACGGACAAGTT
TGTCAAGGACTTTGTGGCAGGGTGGGAGAAGATTATGAACAATGACCGGTTCGACATCAAGAACAAGTCGGTGAGTGCACAATCGCGCGGGGCAAACAAGCCTCGTCTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCCAAGGCGAGTGCCCAGTGAAGAAGGTACCCAACGTCGCCGGCAGTGGTACCAGGAACACCGACTGGTGGCCCAATGAGCTCAGGACAAACATTCTCCGCCAGCACGACCCCAGA
CAGAACCCTCTCGGCCCCGACTTCAACTATGTCGAAGAGTTCAAGAAGCTCGACTACGATGCCTTGAAGAAGGACCTCAATGCCTTGATGACCGACTCGCAGGACTGGTGGCCTGCTGAC
TTTGGTCATTACGGTGGTCTCTT
CATCCGAATGGCATGGCACTCTGCTGGAACCTACCGTGTTACCGACGGTCGTGGTGGTGGCGGTGATGGACAGCAGCGCTTTGCTCCCCTCAACGCC
TGGCCCGACAACGTCTCCCTCGACAAGGCTCGCCGCCTCCTCTGGCCCATCAAGCAAAAGTACGGCAACAAGATCTCATGGGCCGACCTTATGCTCCTCACCGGCAATGTCGCCCTTGAA
TCCATGGGCTGTCCGACTTTCGGTTTCGCCGGTGGCCGTGCCGACACCTTCCAGTCCGACGAGTCGGTCTACTGGGGTGGTGAGACTGAGTGGTTGGGCAGCGATGTCCGCTACGCTGAT
GGTGCAAAGGGTGTCAAGGGCGAGGGCATCATGGACGGCGACCAGCACAAGACTGACAAGAGCGAACCCCACACATCGAGGAACCTCGAACAGCCATTAGCTGCCGCACACATGGGTCTC
ATCTACGTGAACCCCGAAG
GTCCCGAAGGTATACCCGACCCAGTTGCCGCCGCTCACGACATCAGAACAACCTTTGGCCGCATGGCTATGAACGACGCGGAAACCGCTGCCCTCATCATC
GGTGGCCACTCTTTCGGAAAGACCCACGGTGCTGCTCCCTCTGAGAACACCGGCCCAGACCCCAACTCCGAGGACCTCGCAACACAAGGATTTGGCTGGATGAACAAGCACGGTCGTGGC
AACGGCCCAGACACCATCACCAGTGGACTTGAGGTCACCTGGACCGGCACACCCACCAAGTGGAGCAACAAGTACCTCGAGTACCTCTACAAGTTTGAGTGGGAGCTGGAGAAGAGCCCT
GCTGGTGCCAACCAATGGGTTGCCAAGACCGACGAGCACATTATCCCTGATGCGTACGACCAGAACAAGAAGCACAAGCCAAGAATGTTGACCACTGATCTGGCTATGCGTATGGACCCT
GCCTACGAGAAGATCACTCGTCGCTGGTTGGAGCACCCCCAGGAGCTCCACGACACTTTTGTTCGTGCATGGTTCAAGCTTCTCCACCGTGATATGGGTCCTCGCTCCAGGTGGCTCGGT
CCCGAGGTTCCCAAGGAGGTCCTTATCTGGGAAGACCCCGTTCCTCAGCCAGAAGGCGAGCTCATCGGCGAGTCCGATATTGCGACGCTGAAGAAGCAGGTTCTCGACGCTGGCGTTGAG
CCCGCCAAGCTTATCCGCACTGCTTGGGCTTCGGCAGCTTCGTTCCGTGGTAGCGACAAGCGTGGAGGTGCTAACGGCGCCCGCATCCGCCTCGCTCCTCAAAAGGACTGGGAGGTCAAC
AACCCCAAGGAGCTCGCTGAGGTCCTCAAGGCTCTTGAGGGTGTTCAGTCCAAGTTCAACAGCGGCAGCAAGAAGGTTTCCCTCGCCGACTTGATTGTACTTGCCGGTACCGCTGCTGTT
GAAAAGGCCGCCGGTGTACAAGTTCCCTTCACACCTGGCCGCACCGACGCCACACAGGAGCAGACTGATGCCAAGTCTTTCGAGCACCTTGAGCCTGTAACCGACGGTTTCCGCAACTAC
GGCAAGGGAACCGACCGTGTCCGTACTGAGCAGCTTGACGTTGACAAGGCCCACCTTCTCCGCCTCACAGCACCCGAGATGGTTGTCCTCACTGGTGGTATGCGTGCGCTGAACGCCAAC
TGGGACGGCTCATCTCACGGCGTCTTCACCAAGCGCCCCGGTCAACTCACCAACGACTTCTTCGTCAACCTCCTCGATAACAACCTCGAGTGGAAGGCGGCCGACTCTAGCAAGGAGCTC
TACGAGGGTTTCGACCGCAAGTCCGGCCAGAAGAAGTGGACAGCTACCCGCCACGACCTAGTATTTGGTCACCACCCTGAACTACGTGCGGTTGCCGAGACATACGCCCAGGCCGACAAC
ACGGACAAGTTTGTCAAGGACTTTGTGGCAGGGTGGGAGAAGATTATGAACAATGACCGGTTCGACATCAAGAACAAGTCGGTGAGTGCACAATCGCGCGGGGCAAACAAGCCTCGTCTC
TAG

Retrieve as FASTA