Entry information : TviCP01
Entry ID 5799
Creation 2007-09-17 (Marcel Zamocky)
Last sequence changes 2011-05-19 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: TviCP01
Name TviCP01
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Hypocreaceae Hypocrea
Organism Trichoderma virens    [TaxId: 29875 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TviCP01
start..stop
S start..stop
TharCP01 1373 0 1..758 1..761
TatCP01 1345 0 1..756 1..757
TaspCP02 1335 0 1..756 1..758
HjCP01 1318 0 1..758 1..759
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2203849..2204175 327 N° 2 2203388..2203759 372 N° 3 2201749..2203326 1578  
complement(join(2201749..2203326,2203388..2203759,2203849..2204175))


exon

Literature and cross-references TviCP01
Literature Kubicek, C.P., Baker, S.E., Gamauf, C., Kenerley, C.P. and Druzhinina, I.S. Purifying selection and birth-and-death evolution in the class II hydrophobin gene families of the ascomyceteous genus Trichoderma/Hypocrea Unpublished (July 2007)
DNA ref. JGI genome:   scaffold_3 (2204175..2201749)
Protein sequence: TviCP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   758
PWM (Da):   %s   82756.61  
PI (pH):   %s   6.39
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGEAKCPVNHVNVAGGGTRNRDWWPESLKLNILRQHTSVTNPLGADFDYAAAFKTLDYAAVKKDLTALMTDSQDWWPADFGHYGGLFIRLAWHSAGTYRVFDGRGGGGQGQQRFAPLNSWPDNVSLDKGRRLLWPIKQKYGNKLSWADLFILSGNVALESMGFKTLGFAGGRSDTWEADESAYWGGENTWLGNDVRYAHGFAGPTSDGHAVLETDEKSHTDVHSRDLESPLAAAHMGLIYVNPEGPDANADPISAARDIRITFARMAMNDEETVALIAGGHTFGKTHGAGPSTHVGSEPAAAPLENQGLGWVSTFNSGKGPDAITSGLEVTWTKTPTQWSNQFFEYLFKFEWELTKSPAGAKQWVAKNAEPIIPNAFDSSKKQLPTMLTTDLSLRFDPVYEKISRRFLEHPDQFAEAFAKAWFKLTHRDMGPLSRYVGPEIPKEVFSWQDPIPAVDYTLVNDSDIATLKSQILATGVSPSKLISTAWASASTFRGSDKRGGANGARIRLAPQKDWKVNNPPQLAEVLKALEKVQQNFNSSQSGKKVSLADLIVLAGAAAIEKAAKDAGHSVTVPFTPGRNDATQEQTDIESVGYLEPLADGFRNYGRSSPRVKLEHFLVDKAHLLTLSVPELTVLVGGLRVLGTNYDGSTHGVFTNRPGALTNDFFVNLLDMGTVWKADPSDGDLFEGSDRKSGAKKWTGTRVDLVFGSHPELRAVSEVYGSSDAGQKFVNDFVSAWTKVSNLDRFDLPRDSDARPRL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns). Strain="Gv29-8".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCGAGGCCAAGTGTCCCGTGAACCATGTCAACGTCGCGGGTGGCGGAACCAGAAACCGGGATTGGTGGCCCGAGTCTCTCAAGCTCAACATTCTTCGCCAGCACACAAGTGTGACG
AACCCTCTTGGAGCCGACTTTGACTATGCGGCTGCTTTCAAGACTCTTGACTATGCCGCTGTCAAGAAGGATCTTACAGCCCTTATGACCGACTCCCAGGATTGGTGGCCTGCTGATTTC
GGCCACTACGGAGGTCTGTTTATTCGTCTCGCATGGCACAGTGCCGGCACATATCGTGTCTTCGACGGTCGCGGCGGTGGTGGCCAG
GTAAGATGGCATTGACCCTTCTGAACGGAAATC
AATCCGGCCTTTTATTGCAGCTCTTTGAACGTAGCTAACTGAGTCTATTGGAATAGGGCCAACAACGATTCGCACCACTCAACAGCTGGCCAGACAACGTGAGCTTGGACAAGGGCCGTC
GTCTGTTATGGCCTATCAAGCAAAAGTACGGCAACAAGCTTTCATGGGCTGATCTCTTCATCCTGTCTGGTAACGTTGCTCTCGAGTCCATGGGCTTCAAGACCCTTGGATTTGCTGGTG
GCCGTTCAGACACTTGGGAAGCCGATGAGTCTGCCTACTGGGGTGGCGAAAACACATGGCTCGGCAACGATGTTCGATATGCCCACGGCTTTGCTGGCCCTACCAGCGACGGCCACGCTG
TCCTTGAAACTGACGAAAAGTCGCACACTGACGTCCACTCTCGCGACCTGGAGTCTCCCCTGGCAGCT
GTATGTTTTCTTTCCATCCATGTCTGACCACAAAGAATGTTGAACTGACAAT
AGAATGCAGGCGCACATGGGTCTGATTTACGTCAACCCTGAAGGCCCTGATGCCAATGCCGATCCTATTTCAGCCGCTCGGGACATCCGTATTACCTTCGCTCGTATGGCCATGAATGAT
GAAGAGACCGTCGCTCTTATTGCTGGTGGCCACACCTTTGGTAAGACTCACGGCGCCGGCCCTTCAACCCATGTCGGCTCTGAGCCCGCTGCTGCTCCGCTTGAGAACCAAGGTCTCGGC
TGGGTAAGCACTTTCAACTCTGGAAAGGGGCCGGATGCCATCACCAGTGGTCTTGAGGTGACCTGGACCAAGACACCAACTCAGTGGAGCAACCAGTTTTTCGAGTACCTCTTCAAGTTT
GAATGGGAGCTCACCAAGAGCCCTGCCGGCGCCAAGCAGTGGGTTGCTAAGAATGCCGAGCCCATCATTCCCAATGCGTTCGATTCTTCCAAGAAGCAGCTGCCGACCATGTTGACCACG
GATCTGTCACTTCGGTTTGACCCTGTATACGAGAAGATCTCTCGCCGCTTCTTGGAGCACCCCGACCAGTTCGCTGAGGCTTTTGCCAAGGCCTGGTTCAAGCTGACACACCGTGACATG
GGACCTCTCAGCCGATACGTTGGCCCTGAAATCCCCAAGGAAGTGTTCTCCTGGCAGGATCCCATTCCTGCTGTTGACTACACTCTGGTCAACGACAGTGACATTGCTACTCTCAAGAGC
CAGATCTTGGCAACCGGAGTGTCACCATCCAAGCTCATTTCCACCGCATGGGCATCTGCTTCGACCTTCCGAGGCAGCGACAAGCGTGGTGGCGCCAACGGTGCTCGTATCCGCTTGGCA
CCTCAGAAGGACTGGAAGGTGAACAACCCTCCTCAGCTGGCCGAGGTCCTGAAGGCTCTGGAGAAGGTCCAACAAAACTTCAACAGCTCTCAGAGCGGCAAGAAGGTGTCTCTTGCTGAC
CTGATTGTTCTTGCTGGAGCTGCTGCTATTGAGAAGGCCGCCAAGGACGCGGGACACAGCGTCACCGTTCCCTTCACTCCTGGCCGCAACGATGCTACTCAGGAACAGACTGATATTGAG
TCAGTTGGCTATCTCGAGCCCCTTGCTGATGGCTTCCGTAACTATGGCAGGTCTTCTCCAAGGGTCAAGTTGGAGCACTTCCTGGTCGACAAGGCGCATCTTCTCACTCTCTCCGTGCCA
GAGCTGACTGTTCTTGTTGGTGGTTTGCGTGTTCTGGGCACCAACTACGACGGATCAACTCATGGTGTCTTCACCAACCGTCCTGGAGCTCTGACAAACGACTTCTTTGTCAACCTTCTA
GACATGGGTACCGTCTGGAAGGCCGACCCTTCTGATGGTGACCTCTTCGAGGGCAGCGACCGCAAGAGCGGTGCCAAGAAGTGGACCGGTACTCGTGTTGACCTTGTCTTCGGTTCTCAC
CCAGAGCTTCGCGCTGTTTCAGAGGTTTACGGCAGCTCTGATGCCGGCCAAAAGTTTGTCAATGACTTCGTCAGCGCTTGGACAAAGGTCTCCAACCTGGATCGATTCGACCTCCCCAGA
GATTCTGATGCGAGACCCCGTTTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCGAGGCCAAGTGTCCCGTGAACCATGTCAACGTCGCGGGTGGCGGAACCAGAAACCGGGATTGGTGGCCCGAGTCTCTCAAGCTCAACATTCTTCGCCAGCACACAAGTGTGACG
AACCCTCTTGGAGCCGACTTTGACTATGCGGCTGCTTTCAAGACTCTTGACTATGCCGCTGTCAAGAAGGATCTTACAGCCCTTATGACCGACTCCCAGGATTGGTGGCCTGCTGATTTC
GGCCACTACGGAGGTCTGTTTATTCGTCTCGCATGGCACAGTGCCGGCACATATCGTGTCTTCGACGGTCGCGGCGGTGGTGGCCAG
GGCCAACAACGATTCGCACCACTCAACAGCTGG
CCAGACAACGTGAGCTTGGACAAGGGCCGTCGTCTGTTATGGCCTATCAAGCAAAAGTACGGCAACAAGCTTTCATGGGCTGATCTCTTCATCCTGTCTGGTAACGTTGCTCTCGAGTCC
ATGGGCTTCAAGACCCTTGGATTTGCTGGTGGCCGTTCAGACACTTGGGAAGCCGATGAGTCTGCCTACTGGGGTGGCGAAAACACATGGCTCGGCAACGATGTTCGATATGCCCACGGC
TTTGCTGGCCCTACCAGCGACGGCCACGCTGTCCTTGAAACTGACGAAAAGTCGCACACTGACGTCCACTCTCGCGACCTGGAGTCTCCCCTGGCAGCT
GCGCACATGGGTCTGATTTAC
GTCAACCCTGAAGGCCCTGATGCCAATGCCGATCCTATTTCAGCCGCTCGGGACATCCGTATTACCTTCGCTCGTATGGCCATGAATGATGAAGAGACCGTCGCTCTTATTGCTGGTGGC
CACACCTTTGGTAAGACTCACGGCGCCGGCCCTTCAACCCATGTCGGCTCTGAGCCCGCTGCTGCTCCGCTTGAGAACCAAGGTCTCGGCTGGGTAAGCACTTTCAACTCTGGAAAGGGG
CCGGATGCCATCACCAGTGGTCTTGAGGTGACCTGGACCAAGACACCAACTCAGTGGAGCAACCAGTTTTTCGAGTACCTCTTCAAGTTTGAATGGGAGCTCACCAAGAGCCCTGCCGGC
GCCAAGCAGTGGGTTGCTAAGAATGCCGAGCCCATCATTCCCAATGCGTTCGATTCTTCCAAGAAGCAGCTGCCGACCATGTTGACCACGGATCTGTCACTTCGGTTTGACCCTGTATAC
GAGAAGATCTCTCGCCGCTTCTTGGAGCACCCCGACCAGTTCGCTGAGGCTTTTGCCAAGGCCTGGTTCAAGCTGACACACCGTGACATGGGACCTCTCAGCCGATACGTTGGCCCTGAA
ATCCCCAAGGAAGTGTTCTCCTGGCAGGATCCCATTCCTGCTGTTGACTACACTCTGGTCAACGACAGTGACATTGCTACTCTCAAGAGCCAGATCTTGGCAACCGGAGTGTCACCATCC
AAGCTCATTTCCACCGCATGGGCATCTGCTTCGACCTTCCGAGGCAGCGACAAGCGTGGTGGCGCCAACGGTGCTCGTATCCGCTTGGCACCTCAGAAGGACTGGAAGGTGAACAACCCT
CCTCAGCTGGCCGAGGTCCTGAAGGCTCTGGAGAAGGTCCAACAAAACTTCAACAGCTCTCAGAGCGGCAAGAAGGTGTCTCTTGCTGACCTGATTGTTCTTGCTGGAGCTGCTGCTATT
GAGAAGGCCGCCAAGGACGCGGGACACAGCGTCACCGTTCCCTTCACTCCTGGCCGCAACGATGCTACTCAGGAACAGACTGATATTGAGTCAGTTGGCTATCTCGAGCCCCTTGCTGAT
GGCTTCCGTAACTATGGCAGGTCTTCTCCAAGGGTCAAGTTGGAGCACTTCCTGGTCGACAAGGCGCATCTTCTCACTCTCTCCGTGCCAGAGCTGACTGTTCTTGTTGGTGGTTTGCGT
GTTCTGGGCACCAACTACGACGGATCAACTCATGGTGTCTTCACCAACCGTCCTGGAGCTCTGACAAACGACTTCTTTGTCAACCTTCTAGACATGGGTACCGTCTGGAAGGCCGACCCT
TCTGATGGTGACCTCTTCGAGGGCAGCGACCGCAAGAGCGGTGCCAAGAAGTGGACCGGTACTCGTGTTGACCTTGTCTTCGGTTCTCACCCAGAGCTTCGCGCTGTTTCAGAGGTTTAC
GGCAGCTCTGATGCCGGCCAAAAGTTTGTCAATGACTTCGTCAGCGCTTGGACAAAGGTCTCCAACCTGGATCGATTCGACCTCCCCAGAGATTCTGATGCGAGACCCCGTTTGTAA

Retrieve as FASTA