Entry information : TatCP02
Entry ID 5800
Creation 2007-09-18 (Marcel Zamocky)
Last sequence changes 2011-05-20 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: TatCP02
Name TatCP02
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Hypocreaceae Trichoderma
Organism Trichoderma atroviride    [TaxId: 63577 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TatCP02
start..stop
S start..stop
TaspCP01 1535 0 1..794 1..795
TharCP02 1363 0 1..794 1..793
HjCP02 1355 0 1..794 1..792
TviCP02 1335 0 1..794 1..793
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 200271..200592 322 N° 2 199960..200187 228 N° 3 199299..199883 585 N° 4 198666..199237 572
N° 5 198418..198607 190 N° 6 197855..198342 488  
complement(join(197855..198342,198418..198607,198666..199237,199299..199883,1999 60..200187,200271..200592))


exon

Literature and cross-references TatCP02
Literature Kubicek, C.P., Baker, S.E., Gamauf, C., Kenerley, C.P., and Druzhinina I.S. "Purifying selection and birth-and-death evolution in the class II hydrophobin gene families of the ascomyceteous genus Trichoderma/Hypocrea(unpublished July 2007)
DNA ref. JGI genome:   contig_24 (200592..197855)
Protein sequence: TatCP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   794 (776)
PWM (Da):   %s   85378.69 (83619.7)  
PI (pH):   %s   5.44 (5.31) Peptide Signal:   %s   cut: 19 range:19-794
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPLKNVLAIVGALPLASAVGCPVIHGNGNHPARSVISHPESILEPRYSPDGPDFGRCSRKSTVAGGGTRSSQWWPCELNLAVLRQNSDKTNPFGGSFDYGAAFSKVDVAQLKKDITAVQTTSQDWWPADFGNYGPFFVRLAWHNAGTYRSVDGRGGAGMGQQRFAPLNSWPDNANLDKARRLLWPIKQKYGSALSWADLFVFAGNTAMENMGFPTYGFGFGREDTYQSDEGIYWGAEQDMFPTDGNNVVRYNGSTDFTARASELESPLGAVSMGLIYVDPRGPNGTPDTKASALDIRETFGRMGMDDEETVALIAGGHAFGKTHGAESGDDVGPEPNAAPLEQQGLGWKNTFGTGNADDAYTSGLEVIWSRTPTKWANEFLFSLLNNNFTLVQSPGGAPQWEALDANASYPDPFIKGKFRKPTLLTSDLALRDDPIYNNISKTFLNDFDYFTEKFGLAWYKLLHRDMGPISRYLGPDLPKAAPLIWQDPLPSASGYSTLAASDISAIKQQILAAPGLNISNLVTTAWGSASTFRISDKRGGANGARIALQPQASFAVNNPTRLQTVLKLKGIQSKYASSGKTVSLADLIVLGGNAAIESAAKAAGVTLTVPFTAGRVDALQNQTDVSTFAFLEPQADGFRNYGQGTTRSLTEEFLVDKAALLTLSPPELTVLIGGLRALNANFDGSSTGILTSRPGQLTNDWFVNLLGSYSTWSVVNGTNEERFQSVDPKSGKVQWTASRADLIFGSHPELRAIAEVYAGSDSASKFTTDFVAAWSKVMDLDRYDVKGHLGAF

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns). Strain="IMI 206040".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTCTCAAGAACGTCCTGGCCATTGTTGGCGCTCTGCCACTCGCCTCCGCCGTGGGCTGCCCCGTCATCCACGGCAATGGCAACCACCCGGCTCGCTCTGTCATCTCCCACCCAGAG
TCCATTCTGGAGCCCAGATACAGCCCTGATGGCCCCGACTTTGGCAGATGCTCGCGCAAGAGCACCGTGGCTGGTGGAGGCACGCGAAGCAGCCAGTGGTGGCCGTGCGAGCTGAACCTG
GCTGTGCTGCGCCAGAACTCGGACAAGACCAACCCCTTTGGCGGCAGCTTTGACTACGGCGCGGCCTTTTCCAAGGTCGATG
GTGCGTTTTGCTCCTCAGTCCAGCTGTGGAACCTGTGT
CCTACCATCTCTCTCCGTGTACAAGCTGACATCTGCCGTTTGTAGTTGCTCAACTCAAGAAGGACATCACCGCCGTGCAGACCACCTCGCAAGACTGGTGGCCCGCCGACTTTGGCAACT
ATGGTCCCTTCTTCGTCCGTCTCGCGTGGCACAACGCCGGTACCTACCGCTCTGTCGACGGCCGTGGAGGAGCCGGCATGGGACAGCAGCGATTTGCTCCCCTCAACAGCTGGCCCGACA
ATGCCAACCTCGACAAGGCTCGCCGTCTGCTCT
GTAAGTCACTCCGTGCTGTTTGACAGGCAGGGATCTGCATCAGTCATAGTGTGTCATTCTAACGCTGCATGTGCAGGGCCCATCAAG
CAAAAGTATGGCAGCGCTCTCTCCTGGGCTGATCTGTTCGTCTTCGCCGGCAACACTGCCATGGAGAACATGGGCTTCCCCACGTACGGCTTTGGCTTTGGCCGTGAGGATACCTACCAG
TCCGACGAGGGCATCTACTGGGGTGCCGAGCAGGACATGTTCCCCACTGATGGAAACAACGTTGTCCGATACAACGGCAGCACGGACTTCACCGCACGTGCGTCTGAGCTTGAGAGCCCT
CTTGGAGCCGTCAGCATGGGTCTCATCTACGTTGACCCCCGCGGCCCCAACGGCACCCCTGACACCAAGGCCTCTGCTCTGGATATCCGCGAGACCTTTGGCCGAATGGGTATGGACGAT
GAGGAAACCGTCGCTCTGATTGCTGGTGGCCACGCCTTTGGCAAGACCCACGGTGCTGAGTCTGGCGATGATGTCGGCCCTGAGCCCAACGCCGCTCCTCTTGAGCAGCAGGGCCTTGGA
TGGAAGAACACCTTTGGCACAGGTAACGCTGATGACGCCTACACCAGTGGTCTTGAGGTTATCTGGTCTCGAACTCCCACCAAGTGGGCCAACG
GTAAGTGCCCCTTGCATCTGTCATCA
AGAAAAGTACAACATATGCTAACATTTCCCAACAGAGTTCCTGTTCTCTCTGCTCAACAACAACTTCACCCTCGTTCAGTCCCCTGGCGGTGCTCCTCAGTGGGAGGCCCTGGACGCCAA
TGCCTCCTACCCCGACCCTTTCATCAAGGGCAAGTTCCGCAAGCCCACTCTGCTGACCAGTGATCTTGCTCTCCGAGACGACCCCATCTACAACAACATCTCCAAGACGTTCCTCAACGA
CTTTGACTACTTCACTGAGAAGTTTGGTCTCGCCTGGTACAAGCTCCTCCACCGTGATATGGGCCCTATTTCTCGCTACCTTGGCCCTGATCTTCCCAAGGCGGCTCCCCTGATCTGGCA
GGATCCTCTCCCTTCTGCTTCCGGATACAGCACTCTCGCTGCCTCGGATATCTCGGCCATCAAGCAGCAGATTCTTGCAGCTCCCGGCCTCAACATCTCCAACCTCGTCACCACCGCTTG
GGGATCCGCCTCGACCTTCCGTATCTCTGACAAGCGTGGTGGAGCCAACGGCGCTCGCATTGCTCTCCAGCCCCAGGCCTCATTCGCCGTCAACAACCCCACTCGTCTGCAGACTGTTCT
CAAGGCT
GTAAGTAAAGCCATCCATGTCGTTGATCGACGTTTTACTAATACTTCTCCCTCTTTAGCTCAAAGGAATCCAGTCCAAGTACGCCTCAAGCGGCAAGACGGTGTCTCTTGCTG
ATCTCATTGTTCTTGGTGGTAATGCCGCCATCGAGAGCGCTGCCAAGGCTGCTGGTGTCACTCTTACCGTGCCATTCACCGCTGGCCGTGTCGATGCTCTCCAGAACCAGACTGATGTTT
CTACCTTTGCTTTCC
GTGCGTCTACACCCATGCTCCTTTGTCTGCATTCGCTTATATAAGAACCATCATACTGACTTTATGATACTATAGTCGAGCCCCAGGCTGATGGCTTCCGCAACT
ACGGCCAAGGCACTACCCGATCTCTGACCGAGGAATTCCTCGTTGACAAGGCCGCCCTCCTGACTCTGAGCCCTCCTGAGCTGACCGTCCTCATTGGTGGTCTGCGTGCCCTCAATGCCA
ACTTCGACGGCTCCTCCACCGGCATCCTCACCTCTCGCCCCGGCCAGCTCACCAACGACTGGTTCGTCAACCTGTTGGGCTCATACTCCACCTGGTCCGTCGTCAACGGCACCAACGAGG
AGCGCTTCCAGAGCGTCGACCCCAAGTCCGGCAAGGTCCAGTGGACTGCCAGCCGTGCTGATCTCATCTTCGGCTCACACCCTGAGCTGCGTGCCATCGCCGAGGTCTACGCCGGCTCCG
ACTCCGCCTCCAAGTTCACCACTGACTTTGTTGCTGCTTGGTCCAAGGTCATGGACCTTGACCGCTACGATGTCAAGGGACACCTGGGAGCTTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTCTCAAGAACGTCCTGGCCATTGTTGGCGCTCTGCCACTCGCCTCCGCCGTGGGCTGCCCCGTCATCCACGGCAATGGCAACCACCCGGCTCGCTCTGTCATCTCCCACCCAGAG
TCCATTCTGGAGCCCAGATACAGCCCTGATGGCCCCGACTTTGGCAGATGCTCGCGCAAGAGCACCGTGGCTGGTGGAGGCACGCGAAGCAGCCAGTGGTGGCCGTGCGAGCTGAACCTG
GCTGTGCTGCGCCAGAACTCGGACAAGACCAACCCCTTTGGCGGCAGCTTTGACTACGGCGCGGCCTTTTCCAAGGTCGATG
TTGCTCAACTCAAGAAGGACATCACCGCCGTGCAGACC
ACCTCGCAAGACTGGTGGCCCGCCGACTTTGGCAACTATGGTCCCTTCTTCGTCCGTCTCGCGTGGCACAACGCCGGTACCTACCGCTCTGTCGACGGCCGTGGAGGAGCCGGCATGGGA
CAGCAGCGATTTGCTCCCCTCAACAGCTGGCCCGACAATGCCAACCTCGACAAGGCTCGCCGTCTGCTCT
GGCCCATCAAGCAAAAGTATGGCAGCGCTCTCTCCTGGGCTGATCTGTTC
GTCTTCGCCGGCAACACTGCCATGGAGAACATGGGCTTCCCCACGTACGGCTTTGGCTTTGGCCGTGAGGATACCTACCAGTCCGACGAGGGCATCTACTGGGGTGCCGAGCAGGACATG
TTCCCCACTGATGGAAACAACGTTGTCCGATACAACGGCAGCACGGACTTCACCGCACGTGCGTCTGAGCTTGAGAGCCCTCTTGGAGCCGTCAGCATGGGTCTCATCTACGTTGACCCC
CGCGGCCCCAACGGCACCCCTGACACCAAGGCCTCTGCTCTGGATATCCGCGAGACCTTTGGCCGAATGGGTATGGACGATGAGGAAACCGTCGCTCTGATTGCTGGTGGCCACGCCTTT
GGCAAGACCCACGGTGCTGAGTCTGGCGATGATGTCGGCCCTGAGCCCAACGCCGCTCCTCTTGAGCAGCAGGGCCTTGGATGGAAGAACACCTTTGGCACAGGTAACGCTGATGACGCC
TACACCAGTGGTCTTGAGGTTATCTGGTCTCGAACTCCCACCAAGTGGGCCAACG
AGTTCCTGTTCTCTCTGCTCAACAACAACTTCACCCTCGTTCAGTCCCCTGGCGGTGCTCCTCAG
TGGGAGGCCCTGGACGCCAATGCCTCCTACCCCGACCCTTTCATCAAGGGCAAGTTCCGCAAGCCCACTCTGCTGACCAGTGATCTTGCTCTCCGAGACGACCCCATCTACAACAACATC
TCCAAGACGTTCCTCAACGACTTTGACTACTTCACTGAGAAGTTTGGTCTCGCCTGGTACAAGCTCCTCCACCGTGATATGGGCCCTATTTCTCGCTACCTTGGCCCTGATCTTCCCAAG
GCGGCTCCCCTGATCTGGCAGGATCCTCTCCCTTCTGCTTCCGGATACAGCACTCTCGCTGCCTCGGATATCTCGGCCATCAAGCAGCAGATTCTTGCAGCTCCCGGCCTCAACATCTCC
AACCTCGTCACCACCGCTTGGGGATCCGCCTCGACCTTCCGTATCTCTGACAAGCGTGGTGGAGCCAACGGCGCTCGCATTGCTCTCCAGCCCCAGGCCTCATTCGCCGTCAACAACCCC
ACTCGTCTGCAGACTGTTCTCAAGGCT
CTCAAAGGAATCCAGTCCAAGTACGCCTCAAGCGGCAAGACGGTGTCTCTTGCTGATCTCATTGTTCTTGGTGGTAATGCCGCCATCGAGAGC
GCTGCCAAGGCTGCTGGTGTCACTCTTACCGTGCCATTCACCGCTGGCCGTGTCGATGCTCTCCAGAACCAGACTGATGTTTCTACCTTTGCTTTCC
TCGAGCCCCAGGCTGATGGCTTC
CGCAACTACGGCCAAGGCACTACCCGATCTCTGACCGAGGAATTCCTCGTTGACAAGGCCGCCCTCCTGACTCTGAGCCCTCCTGAGCTGACCGTCCTCATTGGTGGTCTGCGTGCCCTC
AATGCCAACTTCGACGGCTCCTCCACCGGCATCCTCACCTCTCGCCCCGGCCAGCTCACCAACGACTGGTTCGTCAACCTGTTGGGCTCATACTCCACCTGGTCCGTCGTCAACGGCACC
AACGAGGAGCGCTTCCAGAGCGTCGACCCCAAGTCCGGCAAGGTCCAGTGGACTGCCAGCCGTGCTGATCTCATCTTCGGCTCACACCCTGAGCTGCGTGCCATCGCCGAGGTCTACGCC
GGCTCCGACTCCGCCTCCAAGTTCACCACTGACTTTGTTGCTGCTTGGTCCAAGGTCATGGACCTTGACCGCTACGATGTCAAGGGACACCTGGGAGCTTTCTAA

Retrieve as FASTA