Entry information : EcabLPO
Entry ID 5807
Creation 2007-09-21 (Marcel Zamocky)
Last sequence changes 2011-08-16 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-08-16 (Christophe Dunand)
Peroxidase information: EcabLPO
Name EcabLPO
Class Lactoperoxidase    [Orthogroup: LPO001]
Taxonomy Eukaryota Metazoa Chordata Mammalia Equidae Equus
Organism Equus caballus    [TaxId: 9796 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcabLPO
start..stop
S start..stop
AImeLPO 1304 0 1..711 6..717
MmulLPO-B 1297 0 1..711 1..712
PpyLPO 1296 0 1..711 1..712
HsLPO 1296 0 1..711 1..712
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 32509928..32510003 76 N° 2 32510924..32511011 88 N° 3 32516046..32516206 161 N° 4 32517599..32517716 118
N° 5 32518140..32518269 130 N° 6 32518996..32519199 204 N° 7 32520460..32520784 325 N° 8 32522701..32522861 161
N° 9 32530415..32530667 253 N° 10 32531502..32531675 174 N° 11 32532621..32532858 238 N° 12 32533065..32533272 208
join(32509928..32510003,32510924..32511011,32516046..32516206,32517599..32517716 ,32518140..32518269,32518996..32519199,32520460..32520784,32522701..32522861,325 30415..32530667,32531502..32531675,32532621..32532858,32533065..32533272)


exon

Literature and cross-references EcabLPO
Literature PREDICTED: Equus caballus similar to Interleukin 20 receptor, alpha
(LOC100056877), mRNA. Unpublished (in June 2007)
Protein ref. GenBank:   XP_001503735.1
DNA ref. GenBank:   NC_009154.2 (32509928..32533272)
mRNA ref. GenBank:   XM_001503685 (1..2136)
Protein sequence: EcabLPO
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   711 (688)
PWM (Da):   %s   80098.89 (77758.5)  
PI (pH):   %s   8.21 (8.09) Peptide Signal:   %s   cut: 24 range:24-711
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRVLVHLPALLASLTLLQAAASATREQSPTTAAISDAVNQVKVQVNKAFLESRTRLKTALSSESPSTRQLSEYLKHAKGRTRTAIRTGQVWEDSLKRLRRKATLTNADPSLDLTALSSEVGCGASVPVVECDAHSPYRTITGDCNNRRNPALGAANRALARWLPAEYEDGLSLPFGWTPSKTRNGFTLPAREVSNQIMGYLTEDVLDHNRPLLFMQWGQIVDHDLDFAPETELGSSEYSKEQCDAYCIQGENCFPIMFPPNDPKLKTQGKCMPFFRAGFVCPTPPYQSLAREQINALTSFLDASFVYGPEPSLASRLRNLSSPLGLMAVNQEVWDHDLAYMPFDNKKPSPCEFINTTAHVPCFLAGDSRASEQILLAASHTLFLREHNRLARELKRLNPQWDGEKLYQEARKILGAFVIITFRDYLPIVLGDEMQKWIPPYQGYNKYVDPRISNVFTSAFRFGHLEVPSTVFRLDENYQPWGPEPELPLHTLFFNTWRIVKDGGIDPLVRGLLAKKSKLMNQNKMMTGELRNKLFQPTHKIHGFDLAAINIQRSRDHGMPGYNSWRGFCDLSQPQTLEELDAVLKNKRLAKKLLDLYRTPDNVDIWVGGIAEPLVERGRVGPLLACLLGKQLQQIRDGDRFWWENPGVFTEKQRDSLQKVSFSRLVCDNTHITKVPVDPFRANHYPHGFVDCSAIDKLDLSPWASVEN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 11, 11 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGGGTCCTTGTACATCTCCCAGCCCTTTTAGCTTCCCTGACTTTGCTCCAGGCTGCAGCATCTGCCACAAGAGGTAAGTGTCTCCCTGTATTGGTTTCCTGGGGCTGATGCAACAAA
GGACAGCAAACTGGTTGGCTTAAGACAACAGAAATCTATTCTCCCACAGTTCCAGAGGCTAGAAGTTCAAAATCAAGGTGTTGGCAGTGTCGTGCTCCTCTGAAGGCCCTAGAGGAGAAT
CCTTCCTTGTGTCTTCCTAACTTCCAGTGGCTCCCAGTAATCCTCGGTGTTTCTTGGCTTACAGCTGCATCACTCCAATCTCTGCCTCCGTCTTCACACGGCCTTCCTCTGTGTGTGTGT
CCTCTCCTCTTGTTGAAAGACCACCAGTCATTGAATTTAGAGCCCACCCTAATCCTGTACATGTATGACTTCTTCTTAATTAATTACATCTGCAAAGACCCTTTTTCCACATAAGATCAC
ATTCTGAGCTTCCATTTGGGGATGTATTTTTAAGGGGTGTATTTAACACCACATTCCCCTTGTTCAGAGACTGCATCCTGCCTGCCATGCTCCAGACCCCAATATGAGTGAAAATAAGGA
ATCCCACCTCTACCCCACACCATTCCCTTCCCTACATCAGGGTCCTAGTGATCAGCTAAGCCCTTTGATGGACTTGCTTAAGGGTCCACCTCACCAAGACCAGAAAATTTCCTTAGCCCA
GTAGCCTGAGTGGTTGCATACCTTCTTAGTCCCATCACTGGGTATTCTAGGGGACTTTTGAAGAGCAATTTTGACAACTTATTGAGGATCAGAGCGTATTCTTCCCATGCTGTGATTTTT
CTCCTTGAAGATTCTTGTGAATGTTTCCCAACCTTGATCTTCTACTGGCTCATATTTGAGGGATGGGGTAATGGCTGGGAAAGAGGGAGACAGAGGCAGAGGACATCTTGAAGGATCGAC
ATCTGATACCCTGCTCCTTGCTTCTCCCCATCCAAGAGCAATCTCCCACGACAGCTGCCATCTCTGATGCTGTGAATCAGGTCAAGGTCCAAGTCAACAAGGCCTTCCTGGAATCCCGGA
CCAG
GTATGACACACACACACACAACGTACGGCCCTTCTGGGGCTTCCTGTTAACAACAAGCACATCTAGGCCAGCCCCGGAAAACCAAAAAGCCAAAGCAATTATACAACCTGCCCTTC
CACCTCCGGGTATGTGGCAAACAGGATATCAGCACACAACTCCTAAAATCCTCAGCCTATAAATTACTTTGAAGAGGCTATCTTATCTAATCCTATGAACACTTTCTTCCACATGGCCAA
ATGTTTCCTTGGGTCATGCCTTCCAGAGTCTCAGAAAGTCTGTACATAGAAGTTGTCCATTCATTCAACTCATATTGACTGACTTAGGTCAGGTTCCCTAGAAGCAGAGCCTGAGAACGG
GTTCTGCAGGTCTTATTAGGTGCAGGTGACTTATTAGGGTGTGCTCTTGGGAAAGTTGTCAGAGTGAGAGAGTAAAGCCAGAGGGGCAAGAGGAGAGAGTTAAGAAGGACGTGGTTTAAG
GTCTAGCCTCAGCCGACCTCACAGGCAGATCTGGAGCATAGGTTGCACCTCAGAGCCTGTCTCATCTTGGAGTAAGGAAGTGGAACTTTCATCTGCCAAATGTTTCCTTGACGTCAGTCA
GATGTGCTGCAGGCTCAGGGCTGAGGGTGGTGCCGCATGCGGTGTAACTGCCAGGCACCTCCAGCCATGCAGCCCCATTGGCTCAGAATCAATCGCCCAGGTAGGTTTCAGGTGTGAGGC
TTCAGCAGCTGCCCCCTCAGCAGCTAGGGGTGGAGCACACCAGCCCTATAAAGGGACCCAAGGGCACTTGGGGATAGGGATCCCGCAGGGCACCAGCAGAGTCAGCCACCCTCCAACCAT
GTGCTGGGGCAGGGATCCCTGAAATAAGCCATGCAGACTGGGTCCCTGCCCTCAGGAAGCCCATACGTGAGCTAGACGAACAAGAGTGACCATTGTGTTGAGCAGAAGACAGGCTTATTC
TTTCCACTCGCTGTCCATTTCCACTAGACTTGGGGCTTCCTTCCTTCTTGGCCCTCAGACGACCTCTCAAGCAGACCCGTCACTTTTTGCTGACTTTAGATGACAAGATTTGCTCTGGTC
ACTCCTCGTCCCGACAGCACAGCAGTGTCCTTTCGGGAATTCAAACGTCAGCACAAGAAGACAAAGCCCAGAGCTTCTCACTTCCCTCAGCTCAGAGCTGCTTTAGGCTTCCAGTGAGGG
AGGCAGCACAGTCTGCTTGTCCCTCCCTCCTGGGCTCCTCCTTCTCCCCCAGCCCAGCTTTCTGACTCCTGAGGGGTTCAGCTAGGGGAGAGAGGAGAGAGACAGGATGGCAAGTCACCT
GGACAATTTAGTGCCTTGTGGGAGGTCTGAGGCTCCCTACTTGGGCACTTTTCAGCTCTCTCTGAATCTGCTGCCAACTCCCTGACCCAGGCAGGTTTCTGGCCAGTAGCTTACAGCTCC
ACCCCTCCGCCTGGAAGCATCCGGCTCACCCCCTCCCCCCTCCACTCCCTCTTGAGCCAGGCTCCTTTTAGGCAGCCTCCGGAAGACTGAAACCTTCGCCCTGCTGCTGGAGGATGTGCA
CATTTGGGGCCCAGTGCTGCCCTGTCTGGCTTACTCTGCTGTTAGGTGCACAGCGTCAGCCACCACTTCTTTTCTCTGGCTCTTTGAGCAGGTATCAACCACCGGCCATGACTGCAGGAC
ACAAAGTCGAGCCCTCCTCCTAAGGCCCTTGTCACGAGAATTAAAGCAAAGAGGAAGCCCCATGGTGGCAGGAGGGAAATGCCTGGCATTTCAGCAACTATCTCCAAATGAAAATTCTTT
CTCTGTCCTTAACTTTAACCCTTTTATAGCCCCAAGGTGGGGATAGAACAAAAGCCACATAATCAGTGTTCATCAGCTCCTTTGTAAGTCATACACAGGACCACCAGCCCTGCTTTGGAA
CTCGTCCCCACTGGTTAGTTCTTGGACTTAAGGGCCTCGTGGAGATGTAAGGAATCCGACTGAAACATCTTGCTACACAAGCACACTGACAATCCAACGACGCATGCTTTGTGATAAGGA
CAACAAAGGAAATAACCAGAGCAATAGTTGCTGCTTTAGGTACAGGGATCAGGGAAGCCTGATGGAGGATGAGAAGGAGCCAGCCATGTAGAGAGCCAGGGGGATGGCATTCCAGGGAAT
GGGAACAGTACAGGCAAAGGTCCTGGGGCAGAAAAGAGCTTAGGGTGCTTAGGAGACAGGAAGAAAGCCAGTGCTGGTGGAGATGGTATGCAAGCAGGAGCACACAGGTGAGGATAGAGA
CATGGACCCTGAGGGCCACAGAGTCAGAAAGCAGACTAGTGGTTGCCAGGGGCCGGCGAGTAGGGTGGGAGGAAGGAATGGGGAGTGACTGCTTAATGAATATGGGGTCTCCTTTGCGGG
TGGTGAAAATGTTTTGGAACTAGATAGAGGCGATGATTATACAACATTATGAGCATGTATGCAGCAAGCAGATGGCTTCATCCACGTTAAAGCAACAAAGCGCTTTAATCAGACAGTGGC
GTGGTCTGCTTTTCATTCTAAAAAGCGCACTCCAGCTGCCCCCTAGGGAATGGAAGGGAGAGGGACAGGAGTGGAGGCAGAAACCCAGTTAGGAGGCTGCTGTGGCCGTCCAGACAGGAG
AGGACGGTGGCTAGGACAAGGGGGAGGCCTGCAGATGGAAAAAGAGTTCAACCAAAGCCCGGCCTCCTCCCACGGAGCCCAGCCCTGAGGCGAAGCAGGAGGTAAGTCCCTGGTGAGTCA
GGTTCAGGCAGGAGAGCCAGGCAGAGAGCAGGGCAGGGGAGGAAGCGAGGAGCGCCTGCACCCTTGCGTGGGGCCTTTCCAGTGGAGCCCTGGGAGGCCCAGCATCCCACCTTCTTTGTT
CATGGGGTGAGGGACCCTGTGGGACCTGGCTGATGATGACGATGACACTGATGCTAACACACGCGTTTAGTCTGTGCCTGACACAGCTCTAGGGTATCTATCCTTCCCAAAATCCTATGA
CGTGCTAAATTGAACTATATGAAATAGCTGTCTGCAAGTTCAAAATGATCAAATAGCATGGAACAACCTAAGGTTACTATCATTATCCTCATTTTATGGGTAAGGAAACTGGGTACAGAG
AGGTTGAGTAAGTTGTCCACAGGCACACTAGTAAGTGGCAGTCAGGAGTCAGACCCAGCCAGTGTGTTCCAAAGGTCACACGCAAGGCCTTGGTGTAAGGAATACTTTGATCCTCGCTTT
GCAGAGGGGCAGGTCACTCAGAGGTCATATCAGTAAACCAATCCTGGTGGAACCAGATTCAAACCTTGCCTCTAGGCCCAAACTCTAGGTCAGTGCTGTCCAATAGAACTTTCTGCAAGG
ACAAAATGTTCTATGTCTGTGCTGTCCAGTACAAGAGCCACTAACTACACATGGCTATTGAGCACTTGAAATGTCACTAGTGCCACAGAGAAACCGAATTTTTAATTTTCCTTAATTTTA
ATGAATTTCCATTTAAATAGCTACACGTGGCTAATGGTTACCATATAGGACAGTGCTGAAGTCTGGGCCACTGCGCCATGATGTCTCCTCCAACAGCAGCAAAAAGACAATCTGGCTTAT
TTTCTGGGGTTTACTTTATCGAGTTGGGGGGAGGCTGGAGGCGGTTGGCCTGGTGATTAGAGCACAGTCGTTACCATTTTGTGCCTGCCCCACTCACGCATGGAGCCACCAGGCTGAGAC
ATGTGCCCCTGGTGCTTGAAATAGAGTTAACCCGATCTATAGTGACAGGCCACGTGTTACAGCCAGTGAATTGTACCCCAGAAGCAGGGTTGTCTTTTGTGAGAATTTGAGCCACTTCCA
ATATTTCAGAGGCTTAGAGCCATAGAGGCCATCTCATAGAAACCCTCATCTCACACATGGAGAAACTGAGGCACGGGGAGGGGTAGATGGTCCTCATGGAGGAACTTTGTTTTTTTAATT
TTTTTTCTTCCTTTTTCTCCCAAAGCCCCCCAGTACATAGTTGTATAGTTTTAGTTGTGGGTCCTTCCAGCTGTGGCACGTGGGATGCCGCCCCAGCATGGCTCAACGAGCGGTACCATG
TCCGCACCCAGGAGTCAAACCAGCAAAACCCCAGGCCACTGATGTGGAGTGGGCAAACTTAACCACTTGGCCACGGGGCTGGCCTCTGGAGGAACTTTCGGTTTTTTGAGGAAGATTAGC
CCTGAGCTAACATCCATGCCCATCTTCCTCTACTTTCTATGTGGGACTCCTGCCTCAGCACGGCTTGACAAGGTTGGTGCCCATGATCCAAACCCACATGCCCAGGGCCGCTGAAGCGGA
GCTTGCAAACTTAACCACTACACCCCCGGGCCAGCCCCTGGAGGAGCTTTTCTCATACACCTTGCCCTCGGTCATCTCTGTGTTGTCACCAGCTTCTTAGTAAAAGGGTTTTTGGTTTCT
CATTTTATACACGGGAAATTAAGAATAAAAAGGCTGAACATCTGGCCCAAGAAATGGTCAGCAAGAGGCTGGCTGCCACAGCCCAAATCTGAACAGCCCCCACAATAGCTCTAGGGCCAG
ATGCCATTAAGGACATTTTCATGGGCAGAACGGAAGGCCCACTGGCATGTTATTTCTAGAATTCTCGGTCCACAAGGCTCAGTGAGATGCCAGCTACGTGTCAGGGGTTCCTCAGTCTGA
ATTAGTCCGTCCTGGATTTTGGGTGTTTTTAAGGTTCCCCAGTTGACGCTGACGCAGCCAGCACAGCTGCAACCCTTTGATTCTAATTCAGGAAGTGCTCACGTCCATCTGCCTGCCTTC
CCTCAGAACCAGACCTCGCAAAGCTTAACGACACACTGGAGCTTCCTCCTCCCAGGAGAGATTTTCAGAGGCGTTAGAAGGAAAACGTGGAAAGATCCTGAGAGCACAGGAAGTGCTTGT
TTTCCACATGCTGCCCGCACCCCTTGGCTGCTCCCTAGACACACACCACCTCACATCCCATCTACAGGGTTGAAGCTGAGGGGCCCGGCCATGACTCCCCCATTGCTCTCCGTTGTAGGC
TGAAGACCGCCCTGAGCTCTGAGTCGCCCAGCACTCGACAGCTCTCCGAGTACCTCAAACATGCCAAAGGCAGGACACGCACAGCCATCCGCACCGGGCAGGTGTGGGAGGACTCCTTAA
AGAGACTGAGGCGGAAAGCGACCTTGACCAACGCCACAG
GTACAGAAAACCCACCAGCTCTCTGATGGCAGGAAGGAGTCATCTCTCTGCAGGAGAGAGCAGAAGCCACCAAAAGCTGCA
TTCCCTATTAAGAGCTCTCTCCTCAGAGAGGCACTCCTGTCTCTCCCTTCTAGAATCATAGACCTGCAGAGCAAGGAGGGGCTGAAATGATAGCTGGGTCAATGCTCTTTTTTGCAGAGA
AAGGAACTTAGGTCCAGCAAGGTCACATTGCCAACTCCAAATGAGGGGACATTCATGCTCTTTGTATAAAACCATCTGCAAGGCCTCTGTTCAGAGGAAATACTTAAGTCAATAAACATG
GGCTCCATGTCCAAACCACAATGTCACCACTTCCGCCTGTGAATGGGACATTTAAGCCACCTGTGTCAAGGGGATTTACTGGGATAATGTCACAGGAGATGAGATTTACATCTTGTTCTG
CGTAACATGGAGCTGAAACGATGAGCTGATGGATTGGTCGTGACCTCCTCCAACCTCTCCAGCCCCACCCCCTGCCAAATGTCACAGCTCACCGAGTGTCATGGAGGAAGGGGTCTGGTC
CTGACCGGAAGAAGAGGCTGCAGGTTCTCCCCAGGAAAACATCAAGTGGGGGAAGATCCTTGGCCTAGGACTTGGGCAAATTCCAAAGATCCCAAAGAAGGAAAGTGGGACCAGGTAGGG
AGAAGTAGGGGGCACTTTGGCTTCTGAGACTCAAAAGGTGCTGGGGTTGAAGGCTGGCCCCTGCCAACCTCCGCAGAGGATCCCCCAGACAAAGCCCGCAGAGAGCCAGATTCCCTGCCT
CTCTTTCCTTGCAGGTGCCAGCATGGGTCACAGGCTGCATTGAGGGTCTGTGCCCACATGGAAGCCTCGGATGCGTCAAGCCGCCACTGTGTTACTCCTCCCCAGCCACAGTGGCCCTCG
CTTAAAAATTACCTGCCCTCCCCACAGCTTTCTTGTCTAGATTTCTGCTTGCTTGCTGCTTTAGATGTCAGTGAAGCTTTAGAAGAAAAGCAATTTTACCAAACTAACTCATACTAACGT
GTACTTAACCACTCAGGGGTATTTTCATTCTAAAAGAAAGATCTGTTGATTCAAAAGATCTGGTAGGCAAAGAATTACTAACAATTCTGGGGACTTTCACAGTTTACTATCTGTGCGGCT
TTGGGCAAGTCTCCTGAGCACCATGGTCTCAGTTTATTCTCTGTAAAGCAGGAATTAAAATTCTTACTTTAAAGGGCTGCCGGGAATAAATGAGAAAACACCGGAGAAAAACTTAGAACA
TAGAATGCATTCCAAAAAATCTAACTTCCCCCTGGTTTCCGTTTCCTGCGTTCCCGCAGTGCGTCAGAATGGAGGAAAACCTCAGCCCCTTTAGCGTCCCTTCTGTTTCAGACCCCAGCC
TGGACTTGACTGCACTCTCTTCCGAGGTGGGCTGTGGTGCCTCTGTTCCTGTGGTGGAATGCGACGCGCACAGCCCTTACCGCACCATCACCGGCGACTGTAATAACAG
GTGAGCACGCA
GGGGAGAGTGTGGCGGCAGGCTCTCGCAGTCACCACACCTGCCCACCCGCCCAGCCCAGCCAGGGGCCCTGGACCTTGGGCATTCCCGCAAAACTGCCACCGCCTTACCCTCCTGGACTT
GGGTCTCACCGGAATCTGTTCTGTTGGAACCCTGCCCTGACTTCCCCACCTTCGAAAAAGACCGCTCTATCCCACAGGAAGCAGCACCCTTCCTCAGGGCAGAGGAACCCCGCGCCTTCA
GGGAGGGGGAGTAGTTCAGAAACCCCACATTTGAGAGGCGCCTCCTCCGCGCCCCCTTTCCTTCGAACAGAGGCTCCCTGGTCCTTCCCCATGGGATCCCCATGGGGTTTGCGGAGAAGC
AAACCCTGGAGCTGACCGGCGGAGGCTGAAGGCGGGTCTTGCTCGGTTTCAGGAGGAACCCTGCGCTGGGCGCCGCCAACAGGGCGTTGGCGCGCTGGCTGCCCGCTGAGTACGAGGACG
GGCTCTCCCTGCCCTTCGGGTGGACGCCGAGCAAGACGCGGAACGGCTTCACTCTCCCGCTG
GTGAGGGCGCGCCGGGGGTGGGGGCGAGTCCCGAGCAGCAGAGTGAAGGCTGGACGCG
AAAGGGGAGAGGATGCACTAATCAAACACACACGGCAAGGAAGAAGAAATAAGTGGGAGGATAGAGGGATGCGCCACGGAGCCGCAGGAGATGGACACTGGAACTTGCTCCCAGGCGATG
TTCCCCAAACTACCACTAGAGGGCAGCAGAGCTCGGAGCCGTGAGGCCAGATACCCCGGGGGTCTCCCAGGCAGATGGCCTCCCTGCCCCATCCTTACCCTGCTCCAGCCCCTGCAGTGC
ATCAGCTGTTGTTTGCCTGGAGGTCCTATCTGTTGGCCTCATCTGAGTTGGCAGCCCCTCTCCAGAGCCCCTCTTCCATTCCCAGACACCTGGCATCTCCGTGGTACTTACTTCAGGGGC
AGCCTGTCTTTGTTTCCCCTCTCCCTAGTGGAAAGGACACTGGCCTTGCAAGTCATCAAGTCATACATCCTGCATTCAGTCCCATCCCTGACCCTTTGTAGCTGCAGGACCTTGGAGAAT
TGACCTTGCCGCTCTAGGACTCAGTCTGCTCATCTACAAAATGGGGATAATGCGCCCCACCTCACAAGCTTGTCATGGGGATTCAATGTACCTGTTACATTGTAGGTACTCAATAACCTG
TAGTTGAATCTGAATCCTCAAAGCACTTTTCCCTCCAGTCCTCCTTCCCCTTCTGTTTCCGTCTGTAGGCCCGTGAGGTGTCCAACCAGATCATGGGATACCTGACTGAGGATGTGCTGG
ACCACAACAGGCCCCTGCTCTTCATGCAGTGGGGTCAAATTGTGGACCATGACCTGGACTTTGCCCCCGAAACCGAGCTGGGGAGCAGCGAGTACTCCAAGGAGCAGTGTGACGCGTACT
GTATCCAGGGGGAAAACTGTTTCCCCATCATG
GTAGGCCCCTCAGCCGCCTGTCCCTGACAAGCCCCTTGCCTCCCTCAGGTAGCAGACATTCCCAGCCTGACAGCCAGGGTCTCTTGGT
AGGCCTTGAATGCTGACTTGACAGCTTCCCTAGCCACATGCATCCATTCATCCACTCATCCATTTATTCAGTAAATAGACATTAATCATCCACTGCATGCCAGGCAGTGCACTAAGCACT
GGGATTCACAGGTGAGTAAGACACTGTTCCTTCCCTCAAGGACAAGGGCGTGTGTGGGAAATGGACAAGTAACCACTACTGGCAAAATTGGGAAGTTTGGGGAGGGTGGTCTCCATCCCT
TGCCCAGCAGCAACCTGGGGACTTATTAGAAATGTAAAACCTCAAGCTTCACCCCAGACATTGGGAAACAGAATCTACATTTTAGCAGGATCCCCAGGAGATTAATTTCGTCTGCAGTAA
AGTTTGTGGAAAGCTGCTCTAAGTCATCCTGGGGTCTGAGAAAGCTGCTCCCAGAAAGAGCTGAAACTCGAGAGATGAATCAGAGTGAGCAGCAAGGATTTGTGGGAGTTTCCAGCAGGA
AGGGAGAGGAACTTGCAATGGTGCGCCTTTGCACCTTTTCTTCTTATTCACGGATTTACAGTTAGAGAGTGATTTCGTCACTCAAACAACAAATCAAGGCTCTGTGCTGTGGTATAAAGA
ACATGAGCTGTGGCGTGAGGTCAATCTGGATCTGAATCTCACATCTTCGTCTTCCGGTTTGTAAGTTGTGGGGCAAATTACATAACCTTTCTGAACCTCAGTTTTCCCACCTGTAAAATG
GGACTGAATTATCTACCTTACAGGGTTTCATGAGGACCAAAGTGAGATAACGTATGCATGATGCCTAGCACGTGGTAGGTCCAAAAAAAACCCAGCGGTAGTTATTGTTAGTAGTAATTA
TTAACAAACCCTTCCTAGCTCATGTCCTGCATCCTTGTCCAGGATCTCAGGACTCCCTCCCCACCAAAAATTTGGAGCCTTTGCTATGAAAGAGAGCAAAGAGCTGAATGATTCCCTTCA
GCACTTTTATCCAGCGAGATGTAATGAACTTCAGGGCAGGAGGTGTAGCGTCAGCAGGAGGCTTCTGAAGTCTGTTTGGTCCCAGGGTCCCAGGAGCGCGCCATCAGCATCTTTGCCAGC
TGCATCCAGCTTCATCCTCTTCCCTGGGGAGAGGTTGCCAGGGCCCAGCTGTGCCACCTCAGCCCAGTCACCCACCCCAATCTCTCCTGCAGTTCCCGCCCAATGACCCCAAGCTGAAGA
CTCAAGGGAAGTGCATGCCTTTCTTCCGAGCCGGATTTGTCTGCCCCACTCCACCTTACCAGTCCCTGGCCCGAGAGCAGATCAATGCTCTGACCTCCTTCCTGGATGCCAGTTTTGTGT
ATGGCCCAGAGCCCAGCCTGGCCAGCCGCCTCCGAAACCTTAGCAGCCCCCTGGGCCTCATGGCTGTCAACCAGGAGGTCTGGGACCACGACCTGGCCTACATGCCCTTTGACAACAAGA
AGCCAAGCCCCTGCGAGTTTATCAACACCACTGCCCACGTGCCCTGCTTCCTGGCAG
GTGAGTCTAGACTGGGAACAGAGGGGCCCACAGGCAAAGGGATTATCCCAAGGACTGAGAGCA
GAGGGAGGCCGGAAAACTTCATGAGACTGCCAGGCAGCTTCTAGAGAGGCTTTACCATTGCTTTTCCTGGTCATCTTCTTAAAAAAATGCACACCAAGCCACTACTGCTTCTGGCAGTGG
TCCAGGACTGGCAGAAGGACCCAGATGAATCCAGCATCTAAGAACATGTGTTCACTGTAAAAAAAAAAAAAAAAAAAGAATCAAGGCAGTCCAGAGAAACACTAAGAAAATCTGCAAAAT
CCACCCACAGATAATCATTGTTAACCTTTAATGCCTATCTTTCCAGTGTTTCTTCCATCATAGTTATAGTTCTACAAAATTGAGGTCATAGGGTAAGTGACGCTCTGTAACCTGATGTCT
TCACTTAATAGATCACATCACTAAACATTCTTCTACAACGTGATTTTTAAGGGCTGCCTGCTCTTCCATGACATATGTTACCATAACTTACCTTATCAACCCTATCCAAAGACATTTAAG
TTCTTTCTAGTTTTTCTGTGATTTTTTCGTTGTTTTTTAGGTAATGAAAATGATTGTTAATGAACGGTTGTGCTCATTTTTAATAATTTTATTGAGATAACTTCCTAGAGAAGGAAGTTC
TTGATTAAGAGGAATGTATATTTTCTTTTCTTCTTCTTCTTCTTCTTTTTTTTTTTTTTTTTGGTGAGGAAGATTGGCCCTGAGCTAACATCTGTTGCCAGTTTTCCTCTTTTTGTTTGA
GGAAGATTGTCTGAGCTAACATCTGTGTCAGTTTTCCTCTATTTTGTATGTGAGATGCTGCCACAGCATGGCTTGATGAGTGATGTGTAGGTCCATGCATGGGATCCAAACCTGCACACC
CCGGGTCACAGAAGTGGAACATGCAAACTTAACCACTATGCCACTGGGCTGGCCCCCAAGGAGGAATGTATATTTTTAAGGCTTTTTATAAACTTGGCACAAAGCCCTTACTCTACACAG
CCTGTGCACAACCAAGCTCCCCGATTCTGTTCATTCCAGGAGCTCATGCCCTCCTGGTCCTCTCTGCCTTTGGCTTCTGGAGGAGGCCTTCCCATTTGCAAAAATCTGCTGTCCCATGAC
AAACCCCCTCCCCACCCAGACGTGGCAGAAGGCTGGCCCATGGGCCCAGATCGCTTTGATTCTGTGTCCACATATGGCTCACATCAATCCAGACACAAAACCAAGCCCTTTCCTCTTTCC
CACAGAAATATCCACTAAGACCAAGCGTTTGTAAACGTAATAGACTTTCTTGCAGATTAGGGGACACACGGAGAAGTCCCTTGTGAAACACCTGGTCTTTTACCGTTTGACTGACACCCC
CTCATGCTGTTCCTCCCTCCCTCCCCACAGCCCCCATCTCCAGGTTCTTCTCCCTTTATTACACAGAGGAATTCAACCCTACCCAGACTTCTGCCCTCAAACTTGCATTCCTAAAACCTT
CCAAGTTGCTGCACACAACAAAAAGCCCCTTGTTTATTTGTACGGCCAAGCCTTAGAGGGCAGTTGGGATTGTGATTAGCAAACGTTCACTTTTTAATGTCGTCTGTAGTGTTTATCGGA
ATCTTGTGAGGTCAGCCTTATTATCCCCATTTTCACAGATACGGAGACTGAGCCTTAGAAATGTTAAGTAATTCATCCAAAGCCACACAGCTTAGAAGTGTGTGTGTAGGGCTGAGATTC
AAACCTGTGAATCCCGACCCCGACCCCTTTCCGCCTGACTTCCCCTAAGTTAACTGGAAGGAGGGGCTTAGGAGAGGGTGTCTTTGGGGCACCATCATTTATTTCTTTGTGCAGGTTACT
GGGTTCGGGGGCTGCTCAAGGGGAACCCACCTTCCTGCCTTCTGGGCTTTCAGGCGATTCCCGAGCCTCGGAGCAGATCCTGCTGGCCGCTTCCCACACCCTCTTTCTCCGAGAGCACAA
TCGGCTGGCCAGAGAACTAAAGAGACTCAACCCTCAGTGGGATGGAGAGAAGCTCTACCAGGAAGCCCGGAAAATCCTGGGAGCCTTCGTGCAG
GTACAGAGGCCCAGGGGCATTGGCTC
ACACGCTCCCTGGCTTCTGCTGCTGGCTCTGCCCTCTGCCCGCCACCACATCTCCAGCTGCCTCCTCCGCTTTCCACATGTCCACTTCCCTTTCCTCTCCTCTGCTGCTTCTTTCCCACC
GACTCATTCTCTTAAGCCCTCCTTTTGTTTCTTCAGCTTCTCTGCCCCAAAATGAATCCCCGGATTCAGATTGTTGGAAAGTTATTCATATGTCCGTCACTCGGTGTGCCTGCCCAGGTG
GCATCTCTGGAATTACTCCTGGGACTGTAACATAGCAGTTATTTTGGTTATTTTGATTGGATTATCTTCTTTTAAAATTCTCTACACCTAAGCCACACGTCACAGGCATAGTCAATTGCT
GTTGTTGGTTGGCTGATGGACTAGCTAGAAGAGACTGACAAAGGTTGATATATTGCTATTAACCGTGCACATATTTTTAAACACGTTATTTTGAAAAAATTGTAGATTCTCAAGAAGTTG
TAAAAAAAATATATACAGGAACCTAGCCTGCCCCCATGCTAAGATTTTGCATAACTATGACACAATATCAAAGGCAGGAAGTTAACACTGATATAAACCATAGAGCTTATTCAGATTTCA
CCAGCTATAAATGCAATCCTCTGTGTGTGCGTGCGTGTGTAGCTCCATGCAATTTTATCACATGTGTAGTTTCATGTAACCACCATCACAATAAAAATGCTTAACTCTACCACCACCACA
AGACTCCCTCATGTGACCCTTTCATAGCCACATCCACCCTCCCCTTTCCATATCCCTAACCCCTGGCAACCACTGGTCTGTTCTCTATCTGAGCAGTTATGCTATTTCACCCATGTTATA
TAAATGAAATCACGCAACATGTATCCTTTTGAGATTGGCTTTTTACATTCAGCATAATTTCCTTGAGGTTCATTCAAGGCGATGCATATATCAATAGTTCATTCCTTTTTGTTTCTAAGT
GGTATTCCATGGTTTAACTATTCACCTACTAAAGAACATTTGGATAGTTTCCAGTTTGGGGTTATTATGAGTAAAGCTGCTATGAACATTTCTGTATAAGTTTCTGCGTGAAAATAAATT
GTTATTTCTCTGGGATATACGCCCAAGAGTGCAATAGCTGGGTCATATGGTAAGCCTATTTTTAGTTTTAAAAGGAACTGCCAAACTATTTTCCAGAGTGGCTGGGTCATTTTTACATTC
CCACCAGCAATGTATGAATGATCCAGTTTCTCTGCATCCTGGTCATTATTTGGTGTCATATCATTTTTTTCACTTTTTCTGATAAGTATGTAGTAATATCTCGTTATGGTTTAATTTCCA
TTTCTTTAATGGCTAATCATATTGAACATCTTCTCATGTGCTTATTTGCCATCTGTATATCCTCTTCAATAAAATACTTGTTCATATATCTTGCCCATTTTCAAATTGGATAAATTTTCT
TTTAATGTTGAGTTTTGAGAGTTCTTTATATATTCCAGATACAAGTCCTTTGTCAGATACGTGACTTTAAATATTTTCTCCCAATGTGTACTTTATCTTTTCATTCTGTTAACAGGGTCT
TTTGTGGAGCAAGAGTTTTTAATATTGATGAGATCATAGTTATCAATTTTCTCCTTTCATGGATTGTGCTTTTGGTGTCAAGTCTCAAGAATTCTTTCCCCAGTCCTAAGTCCCAAAGAT
TTTTCTCCTTTTTTCCCTAGAAGTTTTATGTTTTACATTTAAGTGTATGATCCATTTGGGGTTCATTTTTGTCTGAAGTGTGAGGTGTAGGTCAAGGTTCATTTTTTTGGCCTGTGGATG
TCTAATTGCTCCTGCACCAGTTATTGAAAAGGCTATTTTTTTCTCTTTTCAATTGCTTTTCGTCCTTTGTTAAAAGTTATTTGGGCATATTTATATGAATCTATTTCTGTGTTGTATATT
CTATTCCATTAATCTATGTGTCTTTTCCCACACCCACCGTGTTTAGTTACTGTAGCTACATAGTAAGGCTTAACATCAGGAAGAAGGAGTCTTCCCACATGACTCTTCCTTTTCAAAATT
GTTTTGGCTATTGTATGGTATTTCCCTTTCCACGTATGTTTTTAAACAAGCTTATCTGTGTCTACAAAGAAAACTTGCTGGGATTTTGATAGGAATCGCATTAAAACTATAGATCAATTT
GGGGAGAATTGACATCTTTACAATGTTGAGTTTTCCAATATATAAACACAGTAGGTCTCTCCAAGTATGTGGGTTTCCTTTGGATCTTTCATCAACATTTTGTAATTTTTATTATACAGA
TCCTGTACTTATTTGTTACATTTATGCCTGAGTACTTCATTTTCTTTGGAGGAACTGTAAATGGTATTACATCTCTTATTTCAGTTTCCCCTTGCTTGTTATTAGTAAACAAAAATATAA
TTGGTTTTTGTGTGTTGATCTCATATCCTATGACCTTGCCGAATTCAATGAGTTTTAGGTTCTGTAGACTCCTTGGGATTTCCGGCATACACAATCATGTCATCTACAAAGAAAGACAGC
TGTATTTCTTCTTTTCTAATCTACATGTTTTTTATTTCTTTTTCTTACCTTATTACAGTGGCTATAACTTCCAGTACTATGTTGAATAAGAGTGGTGAGAGCAGACATCCTTGTCTTCCC
AATATTAGAGGAAAAGCATTCAATATTTCACCATTAAATATAATATTAGTTGTAAATTTTTTGTGGATGCTCTTTAGGAGGTTGAGGAAGTTCTGCTCTATGCCTAGTGTACTAAGAGTT
TTTATCATGCATAGATGTTGAGTTTTGTCAAATGCTTTTTCTGCATCACTTTATACAATCATATGACTTTTCTTCTTTAGCCTATTCTGCTTGCTGTGGGTTTATTTTGCTTTTCCTTCT
AGTTTGTTGAGGCAGGAACTTAGATTATTGATCTGAGAGTTTTCCTCTTTTCTAACGAAAGTATTTGGTGATATAAATTTCCTTCTTAGCTCTGCATTAGTTGCATCCCACAAATTTTGG
TCTGTTGTGTTTTCATTTTCATTCAGTATGGTTTTTTGTTTGTTTGCTTTCTTTCAAACTTCCTCTTCGACCTACAGGTTATTTAGAAGTATATTATTTAATTTCTAAGTGTTTGGAGAT
TTTCCTCTTGCCTTTCTTTTATTGGTTTTTAGTTTTATTCCATTGTGGGCACAGAATATACTCTGTATGATTTCAATTCTTTTAAATTTGTTAAGATTTGTTTTATAACCCTGGTATGGT
TATCTTGTTGAATTTTTCATAGGTCCTTAAAAAGAATGTGTATTCTGCTCTGTTGGGTGGAGTATTCCATAAGTGTCAGTTATATCCTGTTGGTTGGTGGTGCTATTCAGTTCTTCTGTA
TCCTTGCTGATTTTCTGTCTAGTAGTTCTATCAATTCCTGGGAGTAGGGTGTTGAAGTCCCCAACTATAACTAAGAAGTTGTCTTTTTTCTCTCAGCTCTATCGGTTTTTGCTTCATATA
TTTTGAAGCTCTGTTGTTTAGTGTGTAAACATTTAGAATTGCTTTATCTTCTTGATGAATAGACCCCTTCTTATTATGTAATGTCCTTTTTTGCCCTTCATGCTTTTCTTTGCTCTGAAG
TCAATTTCATCTGATATTAATATAGCCACCCATGCTTTTTAAAATTAATGTCTCCATGATATATCTTGTTCCATCCATTTCAACCTACCTATGTGATTATGTTTAAAGGTAGTTTCTTGT
AAACAGCATATAGTTGGATTACATTTTTTTAATCTACTCTGCCAATTTCTGTTTTAAATTGGTGTATTTAGATCATTTACATTTAAAGTAATTATTGATGTGTAGGGTTTAAATCTTCCA
TTTTATTATTTGTTTTCTGTTTGATTCCTGTTTCTCATTCCTCTATTGTTATTGTTTTCTTGCCCTTCTGTAGGTTATTTGAACACTTTTTACAGGTCCATTTTGATTTTCATATATCAC
TTGGTACAGTTTCCCTAAGAGTTGTTCTCAGTATTGTCATATATATATATATATATATTTGATATGTCATGTATATACATGACATATCAAAACCTACTGGTGTCAATGGTTTATCATTTT
TCAGTGAGTTATAGAAAACTTACTTCCTTTAGGTCACTACATTTAGCACCATATCAGATGGTGCTTCAACCACAAAACATGATTAAAGAAACTCACAAGGTAGAAAATAATTTAGTATGT
TTGCTTCCATTTTTACTCATTACATTGTTCTTCTTTCCTTTGTGATGCTCCCATCCTTCTTCCTTTTATCATTTTCTTTATGTTTAAAGAGTTTCCTTTAGTCATTCTTTGAGGATAGTC
TGTTAGCAATAAATTCTCTTAGTTTTCCTTCATCTGAAAATGTCTTTATTTCCTCTTTATTCTTGAAGAATAGTTTTACCAGATACTAGAGTCAGGATTGACAGTTCTTTTCTTTCAGCA
CTTGAAAACTCTTGTGCCTCTTCCCTCTGGCCTCTATGATTTCAGATGAGAATTCACTGTTGTTCAAATTGGTGTTCCTTTATAGGTAAGTGTCATTTTTCTTTGGCTGTTTTTAAGACC
TTTTATTTGTATTTACTTTTCAGAAATTTCGTTATGATGTGTCTTGGAGTAGATTTCTTTGGGTTTGTTCTGTTTGAAATTCATTCAGCTTCTTGAATCTGTAAATGTATGTCTTTCACC
AATTTGAGGAAGTTTTCAGGTATTATTTCTTCAAATACTTTTTCAGTCCCATCCCCTTTCTCCTCTACTTCTAGGATTACATTAGTATGCATGTTAGATCTTTTGTTATTGTCCCACAAA
ACCCTGAGGGTCTCTTTGAGAGTCTTTTTTTAAGTCTATTTAGTCTATTTTTTATTTAGTCTGTTTTCTCCCTGTTGTTCAGATTCACTAAACTCTATTGATCTGTCTGCCATTCTATCC
TGTCATCTCCACCCTACTACTGAGTCTGTCCAACAGGTTTCTTATTTCAGTTTGTGTATTTTCAGGTCTATAATTTCAATTCATTTCTCTTTTATAAATTCTACTTTGCTGAGATGTTCT
GGTTTTTCATTTGCTTCAAGCTAACTTATAATTGATTATTGAAGCATTTTTATGGTAGCTGCTTTAGAATCTTTATCAGATAATTCCAACATCTGATTCGTGTCAGTATTGGAATCAGTT
GATCGTCTTTTCTCATTAAAATTGTGGCTTTCCTGGTTCTTGGTATTATGGGTGATTTTCAGTTGTATCCTACGCGTTTTAGTTATTATGTAAGGAGACTCTCAATTCTATTTAAATCTT
CTATTTAAGCAGGTAGTTACCCTGTTTAGGTTTGCCACGTAGCTTCTGGCATACTTTTGTGGGCTTTAGTTCCAATGACACTTTAGTTTCCTGAGCCTTTGCAATGCTATTCTGGTCTGC
TTCATTCTTCTGGTGTGTCTGGGGTTCCCGCTCAGTCCCTGCTGATGCTGTCTGAAGAGCAGGAAGGTACTTTCCTGGCTGCCTTCTGTTGCTAAACAACCTTCTAGTGGAGCAGAAGCT
ACTGCATCTGGGTCTCTTTACGCCATTGAGTGAAGAAGAGAGAGACACAGGGCTTCACTGCTGCAACCCCTCCAGGCAGATCAGACCATTCACCAGCCTGGGTTGTGGATTGAGGGCTGT
GATGGCCAAGAGCTTGGGTTGTGAAGCAACTTTGGTGGCTCTTTACTAGGTCTCTGCTGGACTTTGTCTGTCCCAGCCCTTTGGAGAAAGGGAGAGAAGGCTTTTGTTGGCTTCTTTTGT
CTGTTCCTATTAGGGGTTCCAGGTTGCCAGCCTCTCATGTACCCAGTCTGCAGTATATAGGAACTCAACCACATTGTCATTCCTTAAGTCCTAAGGTCCTCAGCCAGTCCACCTTCTTTC
TAGCTTTCAGAGTCTATTTATTGTTGTCTATTGAATAATTTCCGAGGTATTTAGTTATAGTTAGTGAAAAAGACTAAAGAAAACTGAGTCTACTCCGTCTCGTTCTGGAATCGGAAGCCC
CAACCTGGTATCTCTTCCTCTTCTTATAAGAACACTAGTCCTATTGGATTAGGGCCCCATCTTTACGACCTTATTTAACCCTTTATTAACTCTTATTTAACTCTTTACAGGCCCTATCTC
CAAATACACTCACACTGGGGGTTAGAGTGTCAACAAATGCATCTGAGGGGTACATAATTCTATCCATAACAAGGCTTTTTGGGCTACAGGAAAAGAAACCCACTCAGGCTAATTCAGATA
TTCAGTATGGTTCAACCCTATACATGCGTCAAATGGAAGCTGATAGGGGTTTCTCCTGGAACCCCAGGGCAGTAGTGTAGTTGGGCCTCAGCAAGAGTTAGAGCCAGAGACTGGAAACCA
TCTGGAATTAGGGCAGCTACTCTCACTTTGTCTCTCCCTCCCCTCTGTTCCTTCCTTCACTTCTCCATTGTTCTCCACTCTCTCTCTGCAGATGGGTTTCCTCTGCTTTTCTGCACATGG
TGGAAAATGACAACCCATATGACCCCACGTGTCCCCTCAGATCAAGTGCCATCAGAAACAGTCTAGAATAGCTGTGTCCAAAATCTAAATTCCTGAGAGAGAGAATCTGACCAGCTTGGT
CTGGTGCCACAGCTGGGCCAGTCCACTGTGGCCAGGGGCAGGTTCTGTCTCCTGCTGCCTCCCACAGCCTGAGGAGCAGGCTGTCTGCTCCAAGGATGACATGCCCAGAGTCTATGCTGC
TGAGCAAATTGGATACAACCTAAGAGTAAGGCAATAAGAGAAGGACCCATGAGTATAGTAGGATATTATACATATTTAATTACATAGTAATTGTGGACTAGGTAGAAATGTAAGAAATGT
TAAGCAAAAAAGCAGAATGCAAAATTATGCATTCTCAAGTTCTCTGGGATTACAACTATGTAAAAATGTGTAGCATCTAGACAAAGATTAGAAAGAATAAACATTAACATAATTATTGCA
TTATGTGGTGGCAGGATTTTGTATTTTTTCAAACATTTCTCAGTTTGTGTTAGTTCTTTGTTTTGAGTAAAACCAAACCAGAAACTGATCGCTCCATGGTGCAGCAATTCTTTCAGAACT
GGAGACTGAATGAACTGCCCTTAGTTGCCCTGTGAATCATTCCCATGGTTCTTCATTCCTCTTGCCTTGGCCTATGGGGAAAACTTTAATAACATGGAATCATTATATTAAAGTAACACA
TAAGGGCTGTCACTTTGGCTTCAAGGTCAGAAACTTAGAGCAAAGATGACAAAGAGAGTATATATCTAGTGCCAGTTCAAATGACTGATGAGTAGAGCCTATGTTGAGACAAATCATGAG
AGATCAGCAGAAAGAATGCCTTGATCAATTAGCAATGTCTGCCATGGTCATAAGAAGGGGAATTGGGTATGTATGCTATCCGTTTGCCATCCTTGATTTTGGACCACTCATCCTTCTTGG
CCACAGCTCCTCTCCAACCTTACTCTGCAGAGGTTTAAGTCTTCTCACACTTCTCACACTTCCCTTGTGACATGTTTCTCCTTCCAGATTATCACCTTTAGGGACTACTTGCCCATTGTG
CTCGGTGATGAGATGCAGAAGTGGATCCCTCCATACCAAGGCTACAACAAATATGTGGATCCCCGAATTTCCAATGTCTTCACCTCTGCCTTCCGCTTTGGCCACTTGGAGGTCCCCTCT
ACTGTATTCCGCCTAGATGAGAATTATCAGCCATGGGGACCAGAACCAGAGCTCCCCCTGCACACCCTTTTCTTCAACACCTGGAGAATTGTCAAAGATG
GTACGTCCTTTCAGGGAAGT
GCTGTCACCTGGCTGTCTCACTCTGCAGCTTACTTCTAGGGAAACCTGGCTTGGAAGTCAGACTCTAGACACTTCCTTTGTGACCTTGGACAAGTGAATTCAACTCACTGAGCCTCAGTT
TCCTCATTTGTAAAATGGGGACAATAGTAGTACCTATCACACTAGGATAAACAAAAAATTAAGTGAGATATATGATCATATAATTATATAATTAGCTATTGTTATTAAGCCTCCTCTGGC
CTCTAAGGTACCTAGATTTTCCCTGCTTTTTTTCCTGCCTCAGCCTTCTCTGACCCCTGTAGAAAGAATTCATGGGTTTGGTAAATAAATTGCTCTTTTCTGCTCCCCTCCAGGCCCTTC
CACTTCCATCAAGTGTCAAAGGTTGGACCCCACTCCCCTTTATCCTGGGCTGGGCTGTGTTGAAACTGGCTCTCCTTAATACAAGTCAGGGCTGTTTTCTAGAAACTTCCACCACCTCTT
CCACAGCTGCAAAGTTCCTCAGGGGAACAGATGGAAAGAAAAGGAGCCAACTCTCTGAACTAGAGCTTGGAAAAAATCCTGAAGCTTATATTCATGCCATTATCCCAGGAATGCCCCTTT
CTCCCACCCCCAGCCAGTCAGTCTGGACTGTCCCACCCCGACCCCAGCACCCCCTGCAGGCTGCATTATGCTCTTCTCTCCCCATTCCAGCCTGAGACATTCAGTTGGCCCTACTTTCCC
CTGAAAGAAAACGTCTGGTGGAGGGAGGGGCTAGCAGTGCAAGATGTCCCCACCCTACCCCATTCCCAGTATGGCCTCTCTGTCTCCCTCGCAGGTGGAATTGACCCTCTGGTGCGGGGC
CTCCTGGCCAAGAAGTCCAAGTTGATGAATCAGAATAAAATGATGACAGGAGAGCTGCGAAACAAGCTCTTCCAGCCCACTCACAAGATCCACGGCTTTGACCTGGCTGCCATCAACATA
CAGCGTTCCCGGGACCACGGGATGCCTG
GTGGGCCTGGGGTCTGGCCGGGCCTAGGGCCTAGGGTTCCAGGGGGACTTTCTTCTATAACCTATAATCCTGAGGGTCTGATCAATTCTAGC
AAGTCTTTTTTTTTTTTTGAAGATTGGCCCTGAGCTAACATCTTTTCCCAATCTTCCTCTTTTTTTTTCCCCTCCCCAAGCCCCAGTACCTAGTTGTATATCCTAGTTGTGGGTCATTCT
AGTTCCTCCACGTGGGATGCGGCCACAGCATGGCTTAATGATCAGTGTGTAGGTCCGTGCCCAGAATCTGAACTGGAGAACCCCAGGCCGCCAAAGCAGAGCACGTGAACTTAACCACTC
AGCCACAGGGCCAGCCCCTGATCAGTTCTAAAACAGAAGGCAGAGATGCCAGCTTTTAAAACTCACTGTGCTCATCTGTGAAGTGGAATCTTCCATTCTCCCTAATGCAGAGGAAAGAAG
ACATATCTGGTGCTATCCTGGAGCACCTCAAGTGAAAAAGAGATCAACTGACTTATAAGACCAGTTTAAAAGCCCAGAAAAGATTAAGAAAAGGAGAATAGAGAGAAACCAGTGACCACT
GGACCTTTCTTTTGTACCCATGCAAGGCAATTTAATGTTGTAACTAAGAGCCAGACTGCCTGGGTTCAAATCCCAGCTGTGCCATTTCTAGTTATGTGACCTTAGGCAAGTTACTTAACA
CCTTGGTTCTTCAGTTTACGTATTTGTACAGTGCTTAGAATAGTGCCTGGACCCACGGTAAGTACCATATAACCTATGAGCCCTCTGAGACTAAAATGCCACAGACATAAAACAATGGAC
CACCACTTCCCCTGTCCCAAAGGCTGTGAGGCCAGGCTTTCTGGGGCTGATGGAGCTGGAGTGGGTATGTCTCCAAGTGGGGCTTCGGGTGAGAAGTCCCTGGGATGAGACAGCTTCAGC
TTGTCTGCCCTAGGGTACAACTCCTGGAGAGGCTTCTGCGACCTCTCACAACCCCAGACACTGGAAGAGCTGGATGCTGTGCTGAAGAACAAGAGGCTGGCTAAGAAATTACTGGATCTC
TACAGGACCCCTGACAACGTTGACATCTGGGTGGGAGGCATTGCTGAGCCCCTGGTAGAAAGGGGCCGGGTGGGGCCTCTCCTGGCCTGCCTCCTGGGGAAGCAGTTGCAGCAGATCCGT
GATGGAGACAG
GCAAGTGAGACGTCAGCGGGGAGGGTGGGGGAGGGCAGACCCTTCTCTGAGGTGGGTGTCCCGACGTCCTTTGTGAGGACTAACCCGGACCTCAGCATGTTCCCAATGA
CCTCTTTTCTTCCCCTTTGGCACAGTGTGGGGGTGCGGGGGTGGGGGGGCGGCCAACAGCTGGGCTGTATGGAGAAACCTGGCTTCTGTCTCTGCAGGTTCTGGTGGGAGAACCCTGGTG
TCTTCACTGAGAAGCAGCGAGACTCTCTACAGAAAGTGTCCTTCTCACGCCTTGTCTGTGACAACACCCACATCACCAAGGTCCCAGTGGACCCATTCCGGGCCAACCACTACCCCCATG
GTTTTGTGGATTGCTCAGCCATTGATAAGCTGGACCTCTCACCCTGGGCCTCAGTGGAGAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGGGTCCTTGTACATCTCCCAGCCCTTTTAGCTTCCCTGACTTTGCTCCAGGCTGCAGCATCTGCCACAAGAGAGCAATCTCCCACGACAGCTGCCATCTCTGATGCTGTGAATCAG
GTCAAGGTCCAAGTCAACAAGGCCTTCCTGGAATCCCGGACCAG
GCTGAAGACCGCCCTGAGCTCTGAGTCGCCCAGCACTCGACAGCTCTCCGAGTACCTCAAACATGCCAAAGGCAGG
ACACGCACAGCCATCCGCACCGGGCAGGTGTGGGAGGACTCCTTAAAGAGACTGAGGCGGAAAGCGACCTTGACCAACGCCACAG
ACCCCAGCCTGGACTTGACTGCACTCTCTTCCGAG
GTGGGCTGTGGTGCCTCTGTTCCTGTGGTGGAATGCGACGCGCACAGCCCTTACCGCACCATCACCGGCGACTGTAATAACAG
GAGGAACCCTGCGCTGGGCGCCGCCAACAGGGCGTTG
GCGCGCTGGCTGCCCGCTGAGTACGAGGACGGGCTCTCCCTGCCCTTCGGGTGGACGCCGAGCAAGACGCGGAACGGCTTCACTCTCCCGCTG
GCCCGTGAGGTGTCCAACCAGATCATG
GGATACCTGACTGAGGATGTGCTGGACCACAACAGGCCCCTGCTCTTCATGCAGTGGGGTCAAATTGTGGACCATGACCTGGACTTTGCCCCCGAAACCGAGCTGGGGAGCAGCGAGTAC
TCCAAGGAGCAGTGTGACGCGTACTGTATCCAGGGGGAAAACTGTTTCCCCATCATG
TTCCCGCCCAATGACCCCAAGCTGAAGACTCAAGGGAAGTGCATGCCTTTCTTCCGAGCCGGA
TTTGTCTGCCCCACTCCACCTTACCAGTCCCTGGCCCGAGAGCAGATCAATGCTCTGACCTCCTTCCTGGATGCCAGTTTTGTGTATGGCCCAGAGCCCAGCCTGGCCAGCCGCCTCCGA
AACCTTAGCAGCCCCCTGGGCCTCATGGCTGTCAACCAGGAGGTCTGGGACCACGACCTGGCCTACATGCCCTTTGACAACAAGAAGCCAAGCCCCTGCGAGTTTATCAACACCACTGCC
CACGTGCCCTGCTTCCTGGCAG
GCGATTCCCGAGCCTCGGAGCAGATCCTGCTGGCCGCTTCCCACACCCTCTTTCTCCGAGAGCACAATCGGCTGGCCAGAGAACTAAAGAGACTCAAC
CCTCAGTGGGATGGAGAGAAGCTCTACCAGGAAGCCCGGAAAATCCTGGGAGCCTTCGTGCAG
ATTATCACCTTTAGGGACTACTTGCCCATTGTGCTCGGTGATGAGATGCAGAAGTGG
ATCCCTCCATACCAAGGCTACAACAAATATGTGGATCCCCGAATTTCCAATGTCTTCACCTCTGCCTTCCGCTTTGGCCACTTGGAGGTCCCCTCTACTGTATTCCGCCTAGATGAGAAT
TATCAGCCATGGGGACCAGAACCAGAGCTCCCCCTGCACACCCTTTTCTTCAACACCTGGAGAATTGTCAAAGATG
GTGGAATTGACCCTCTGGTGCGGGGCCTCCTGGCCAAGAAGTCC
AAGTTGATGAATCAGAATAAAATGATGACAGGAGAGCTGCGAAACAAGCTCTTCCAGCCCACTCACAAGATCCACGGCTTTGACCTGGCTGCCATCAACATACAGCGTTCCCGGGACCAC
GGGATGCCTG
GGTACAACTCCTGGAGAGGCTTCTGCGACCTCTCACAACCCCAGACACTGGAAGAGCTGGATGCTGTGCTGAAGAACAAGAGGCTGGCTAAGAAATTACTGGATCTCTAC
AGGACCCCTGACAACGTTGACATCTGGGTGGGAGGCATTGCTGAGCCCCTGGTAGAAAGGGGCCGGGTGGGGCCTCTCCTGGCCTGCCTCCTGGGGAAGCAGTTGCAGCAGATCCGTGAT
GGAGACAG
GTTCTGGTGGGAGAACCCTGGTGTCTTCACTGAGAAGCAGCGAGACTCTCTACAGAAAGTGTCCTTCTCACGCCTTGTCTGTGACAACACCCACATCACCAAGGTCCCAGTG
GACCCATTCCGGGCCAACCACTACCCCCATGGTTTTGTGGATTGCTCAGCCATTGATAAGCTGGACCTCTCACCCTGGGCCTCAGTGGAGAATTAG

Retrieve as FASTA