Entry information : BfuLDS01
Entry ID 5855
Creation 2007-10-11 (Marcel Zamocky)
Last sequence changes 2007-10-11 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: BfuLDS01
Name BfuLDS01
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Ascomycota Leotiomycetes Sclerotiniaceae Botryotinia
Organism Botryotinia fuckeliana (Botrytis cinerea Sclerotinia fuckeliana)    [TaxId: 40559 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BfuLDS01
start..stop
S start..stop
SsclLDS01 2207 0 10..1117 73..1180
CposLDS03_silveira 1282 0 39..1114 37..1109
CimLDS03 1277 0 39..1114 37..1109
AflLDS03 1236 0 2..1111 22..1118
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 361522..361887 366 N° 2 361334..361473 140 N° 3 360878..361277 400 N° 4 360596..360831 236
N° 5 360454..360543 90 N° 6 359456..360402 947 N° 7 359201..359404 204 N° 8 358802..359150 349
N° 9 358574..358755 182 N° 10 358415..358524 110 N° 11 358003..358365 363  
complement(join(358003..358365,358415..358524,358574..358755,358802..359150,3592 01..359404,359456..360402,360454..360543,360596..360831,360878..361277,361334..3 61473,361522..361887))


exon

Literature and cross-references BfuLDS01
Literature REFERENCE 1: Birren,B., et al., The Broad Institute Genome Sequencing Platform. Annotation of the Botryotinia fuckeliana B05.10 genome.
REFERENCE 2: Silva,E.M., Valdes,J., Holmes,D., Shmaryahu,A. and Valenzuela,P.D. Generation and analysis of expressed sequence tags from Botrytis cinerea. Biol. Res. 39 (2), 367-379 (2006).
Protein ref. GenBank:   XP_001557644.1
DNA ref. JGI genome:   Supercontig_1.15 (361887..358003)
mRNA ref. GenBank:   XM_001557594
EST ref. GenBank:   EB809814 [Fragment]
Protein sequence: BfuLDS01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1128
PWM (Da):   %s   126005.69  
PI (pH):   %s   6.61
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEQPHQGGPARRLTLGVPKKSTSGNASSNPQVFEGPDHSVKRAGIVGTLESLGKVISTANRPLNTETGDGSYDTKQEQSGLLDDLKALRIKDLETLQMTMKQELGSSNLADDKTMLMEKLIQLVANLPGTSKTRVKLTEVLVDELWGSLEHPPASMLGDKYNYRQADGSFNNIRFPDIGKAGTAYARSVTPKIVQPNPKPDPGLIFDTIMSRENGGFKPHPNNISSMLYYIASIIIHDCFRTSHEDFNISMTSSYLDLSPLYGSNQDEQNNMRTLKDGELKPDCFSEKRLLGFPPGVGCILMFNRFHNYVVKQLATINENGRFTPPKDNLPDDKKQAAWKKYDNDLFQTGRLITCGLYINIILLDYLRTIVGLNRVNSTWTLDPRIEMERNSKPGTEAGVGNQCAAEFNLVYRWHSCISQRDEKWSEDLYMKIFGKSYKEVTMQELLIGLGKLEAMTPEDPLQRDFAGMKRGTDGKLNDDDLVNELTASIEDLAGSSGANNVPAVLRAVEILGMEQARAWKCATLNEFRKHFGLIPHEKFSDINSDPAVYEKLKVLFDEPDLVELYAGLVCEDAKKPMDPGVGIGPTYTISRSILSDAVTLVRGDRFYTTDYHPANLTNWGVTEVKYDLNVNQGCVFYKLFIRAFPNHFSYNSIYAHYPLTIPSENKKIMEKLGRADDYSWDKPVKVPERKNIVTFDGVKSVLTNAEVFGVDNWRRGLAYLMGKGANFMLAGDGDFFAERRNQMKECLYQDKWHESVKNYYESIVPRLLKRWSYNIGGTTNQVDVIRDIDNSAHVHFAANVFHLPLKTEENPKGVYTEHELYMVLAVIFIVIFFGDVDPAKTFSLRAAGLPVTQDLGQLVEQNVNFISKTSLVSGIVDTFMEENNALKDYGVHMVRHLLKAGLGVHETVWSQILPTAGAMVANQAQVFGQVLDFYLGDGKEHLPEINRLAKLNTAEADDILLHYLLEGRMYGTFGAYRTCHQNITINDGSRKVECKPGDSVFVSVSLAQDPKIYPDPKTVRLDRPVDSYLVYGVGSHACLGGEASRVALTAMLKCIGRLDNLRRASGPQGEMKKVPREGGFYVYMDKMMGSEFPFPTTMKICWDGGLNEPVPVVEKGKGKKNGA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (10 introns) and 1 EST. Strain="B05.10". Regions: 163-627 peroxidase domain, 969-1085 cytochrome P450 domain.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCAACCTCATCAGGGCGGCCCAGCACGTCGTTTGACTTTAGGTGTGCCTAAAAAGTCTACTAGTGGTAATGCAAGCTCCAATCCTCAAGTATTCGAAGGTCCCGATCACAGTGTA
AAACGCGCTGGTATCGTAGGAACTCTCGAGTCACTCGGAAAAGTCATTAGCACGGCCAATCGTCCTTTAAACACCGAAACTGGAGATGGCTCATACGATACAAAACAAGAGCAGTCGGGC
TTGTTGGATGATCTCAAAGCATTGCGAATTAAGGATCTGGAAACATTGCAGATGACTATGAAGCAAGAACTAGGATCCTCAAATCTAGCAGATGATAAGACCATGTTAATGGAGAAGCTT
ATTCAG
GTAAGTCTGTCCCTTGAATTTCGACACATAAGAACTAAGATTGGACAGTTGGTTGCAAACCTTCCTGGAACCTCCAAGACTCGAGTTAAGCTTACGGAAGTACTCGTTGATGAG
CTATGGGGATCCTTGGAACATCCACCAGCTTCAATGCTTGGTGATAAGTACAATTACCGACAAGCTGATGGCTC
GTGAGTATACCATCAGAATCATTCAGGTTATATCTCCAACTAATCA
TTATTCGTAGATTCAATAACATCAGATTTCCCGACATTGGAAAAGCAGGCACAGCATACGCTCGAAGTGTTACTCCAAAAATTGTTCAACCAAACCCAAAACCAGATCCAGGCCTTATAT
TCGACACAATCATGAGTCGAGAAAATGGTGGATTCAAGCCCCACCCGAACAATATATCTAGTATGCTTTACTATATTGCAAGCATTATCATTCATGACTGCTTCCGTACCTCGCACGAAG
ATTTCAATATTTCAATGACCTCCTCTTATTTAGATCTTTCTCCTTTGTATGGAAGTAACCAGGATGAACAAAATAACATGCGCACACTTAAAGATGGAGAACTAAAACCGGATTGTTTCT
CCGAGAAGAGATTGTTAGGTTTTCCTCCTGGAGTTGGATGCATTCTTATT
GTAAGTTGCTTATATGAACCAGAGACCTACAACTAAAGCTTAATAGATGTTCAATCGTTTTCACAACTAT
GTAGTGAAACAATTGGCAACAATAAACGAGAATGGACGCTTTACACCCCCCAAAGACAATCTACCAGACGATAAAAAGCAAGCAGCCTGGAAGAAGTATGATAATGATCTATTTCAAACC
GGACGGCTTATTACTTGCGGTCTCTACATTAACATCATTCTGCTCGATTATCTCCGCACAATCGTCGGTCTGAATCGAGTCAATTCTACCTG
GTAAGAGTCGTTTAAATTTAGACGAAGA
AATCATATAGCTAAAATCCAATAGGACTCTTGATCCTCGAATCGAAATGGAAAGAAACAGCAAGCCCGGAACTGAAGCTGGAGTCGGGAACCAATGTGCTGCCGAATTCAATCTGTAAGC
CTTTCATTAACTTGTCTTCCCACATGTAAAGCTAAGTGTACATAGCGTGTATCGATGGCATTCCTGTATCAGTCAACGTGATGAGAAATGGTCAGAAGATCTGTACATGAAAATCTTTGG
AAAGAGCTACAAGGAAGTCACCATGCAGGAGCTTCTCATTGGTTTGGGTAAACTCGAAGCAATGACACCAGAAGATCCCCTACAACGAGATTTCGCTGGTATGAAGAGAGGCACTGACGG
AAAACTCAATGATGATGATCTTGTCAACGAGTTGACCGCCAGTATAGAAGACTTGGCTGGGTCATCAGGAGCAAATAACGTTCCTGCAGTCCTGCGTGCTGTTGAAATCCTTGGGATGGA
ACAAGCTCGTGCATGGAAGTGCGCAACTCTAAATGAATTCCGCAAACACTTTGGCCTTATACCACATGAAAAGTTTTCAGATATCAATTCAGATCCAGCCGTCTATGAAAAATTGAAGGT
TCTGTTCGATGAGCCTGATTTGGTCGAACTTTACGCCGGATTGGTTTGTGAAGATGCCAAGAAGCCTATGGATCCAGGTGTTGGCATTGGACCGACCTATACAATCAGTCGTAGCATTCT
TTCTGACGCAGTTACATTGGTTCGTGGTGACAGATTTTATACCACCGACTATCATCCAGCAAACCTTACGAATTGGGGCGTCACCGAAGTCAAGTATGATTTAAACGTCAATCAAGGTTG
CGTTTTCTACAAATTGTTCATCCGAGCTTTCCCAAATCATTTCTCGTATAATAGCATATATGCCCACTATCCTCTTACGATACCGTCTGAAAACAAAAAGATTATGGAGAAACTCGGCCG
TGCAGATGATTACAGCTGGGACAAACCAGTCAAGGTTCCAGAACGAAAGAATATTGTCACCTTTGATGGAGTCAAGAGTGTTCTTACCAATGCAGAAGTGTTTGGCGTTGATAATTGGCG
CAGAGGTCTTGCTTACCTCATGGGAAAACCAG
GTATATAAGCTCGTTGCGAATGCTATACGCCCAGTACTAATATAACTTTAGGTGCTAATTTCATGTTGGCTGGTGATGGCGACTTCTT
TGCAGAGCGTCGTAATCAAATGAAGGAATGTCTTTACCAAGACAAATGGCACGAGAGTGTCAAGAACTACTACGAAAGTATTGTTCCAAGACTCCTCAAGAGATGGTCCTACAATATCGG
TGGCACGACCAACCAGGTTGATGTCATTCGCGATATTGATAATTCCG
GTGAGAATTTCGTCAACTGGGTCTTTCTGTTTTTGTCTAACATTACCTAGCTCATGTACACTTTGCCGCCAAT
GTTTTCCACCTACCACTCAAGACCGAAGAGAATCCCAAAGGTGTATATACCGAGCATGAATTGTACATGGTGTTGGCTGTTATCTTCATCGTTATATTTTTTGGTGATGTCGACCCAGCC
AAAACGTTTTCATTACGTGCTGCTGGTCTTCCGGTTACACAAGATCTTGGTCAACTAGTTGAGCAAAACGTGAACTTTATCTCAAAGACTAGTCTTGTATCGGGTATCGTTGATACTTTC
ATGGAAGAAAACAACGCACTTAAAGATTACGGTGTGCACATGGTGCGCCATTTGTTGAAGGCTGGCTTGGGCGTTCATGAGACTGT
GTTAGTGTATCCTCCAATCGCTCACTATGTTTAC
TAATGTTTTTAGTTGGTCACAAATTTTGCCAACAGCAGGAGCAATGGTAGCAAACCAAGCACAAGTTTTTGGTCAAGTCCTCGACTTTTATCTTGGTGATGGCAAAGAGCATCTTCCGGA
GATTAACCGTCTTGCAAAGCTCAACACAGCAGAAGCAGATGATATTCTCTTACATTACCTGTTGGAAGGAATTA
GTAAGCTCTACCTGTCTGATCTGTTGTACCGTTTGCTAACAATATA
CAGGAATGTACGGCACATTCGGTGCTTACCGAACATGTCATCAAAACATTACCATCAACGATGGATCTCGAAAAGTCGAGTGCAAGCCTGGCGATTCAGTTTTCGTCAGTTTCGTATGTC
TCCATTTGTAGATCTCATAAATATAAACTAACAAAACCTCAGGTTTCACTAGCCCAGGACCCTAAAATCTATCCCGATCCAAAGACAGTTCGTCTAGATCGTCCAGTTGATTCTTACCTC
GTGTATGGCGTCGGTTCCCACGCTTGTCTCGGCGGTGAAGCTTCGCGTGTAGCTCTTACAGCCATGCTTAAATGCATTGGCCGACTTGACAATTTGAGAAGAGCATCTGGTCCTCAGGGT
GAAATGAAGAAGGTTCCAAGAGAAGGAGGATTCTATGTTTATATGGATAAGATGATGGGATCCGAATTCCCCTTCCCGACTACGATGAAGATTTGTTGGGATGGAGGGTTGAATGAACCG
GTACCGGTGGTGGAGAAGGGGAAAGGAAAGAAGAATGGCGCATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCAACCTCATCAGGGCGGCCCAGCACGTCGTTTGACTTTAGGTGTGCCTAAAAAGTCTACTAGTGGTAATGCAAGCTCCAATCCTCAAGTATTCGAAGGTCCCGATCACAGTGTA
AAACGCGCTGGTATCGTAGGAACTCTCGAGTCACTCGGAAAAGTCATTAGCACGGCCAATCGTCCTTTAAACACCGAAACTGGAGATGGCTCATACGATACAAAACAAGAGCAGTCGGGC
TTGTTGGATGATCTCAAAGCATTGCGAATTAAGGATCTGGAAACATTGCAGATGACTATGAAGCAAGAACTAGGATCCTCAAATCTAGCAGATGATAAGACCATGTTAATGGAGAAGCTT
ATTCAG
TTGGTTGCAAACCTTCCTGGAACCTCCAAGACTCGAGTTAAGCTTACGGAAGTACTCGTTGATGAGCTATGGGGATCCTTGGAACATCCACCAGCTTCAATGCTTGGTGATAAG
TACAATTACCGACAAGCTGATGGCTC
ATTCAATAACATCAGATTTCCCGACATTGGAAAAGCAGGCACAGCATACGCTCGAAGTGTTACTCCAAAAATTGTTCAACCAAACCCAAAACCA
GATCCAGGCCTTATATTCGACACAATCATGAGTCGAGAAAATGGTGGATTCAAGCCCCACCCGAACAATATATCTAGTATGCTTTACTATATTGCAAGCATTATCATTCATGACTGCTTC
CGTACCTCGCACGAAGATTTCAATATTTCAATGACCTCCTCTTATTTAGATCTTTCTCCTTTGTATGGAAGTAACCAGGATGAACAAAATAACATGCGCACACTTAAAGATGGAGAACTA
AAACCGGATTGTTTCTCCGAGAAGAGATTGTTAGGTTTTCCTCCTGGAGTTGGATGCATTCTTATT
ATGTTCAATCGTTTTCACAACTATGTAGTGAAACAATTGGCAACAATAAACGAG
AATGGACGCTTTACACCCCCCAAAGACAATCTACCAGACGATAAAAAGCAAGCAGCCTGGAAGAAGTATGATAATGATCTATTTCAAACCGGACGGCTTATTACTTGCGGTCTCTACATT
AACATCATTCTGCTCGATTATCTCCGCACAATCGTCGGTCTGAATCGAGTCAATTCTACCTG
GACTCTTGATCCTCGAATCGAAATGGAAAGAAACAGCAAGCCCGGAACTGAAGCTGGA
GTCGGGAACCAATGTGCTGCCGAATTCAATCT
CGTGTATCGATGGCATTCCTGTATCAGTCAACGTGATGAGAAATGGTCAGAAGATCTGTACATGAAAATCTTTGGAAAGAGCTACAAG
GAAGTCACCATGCAGGAGCTTCTCATTGGTTTGGGTAAACTCGAAGCAATGACACCAGAAGATCCCCTACAACGAGATTTCGCTGGTATGAAGAGAGGCACTGACGGAAAACTCAATGAT
GATGATCTTGTCAACGAGTTGACCGCCAGTATAGAAGACTTGGCTGGGTCATCAGGAGCAAATAACGTTCCTGCAGTCCTGCGTGCTGTTGAAATCCTTGGGATGGAACAAGCTCGTGCA
TGGAAGTGCGCAACTCTAAATGAATTCCGCAAACACTTTGGCCTTATACCACATGAAAAGTTTTCAGATATCAATTCAGATCCAGCCGTCTATGAAAAATTGAAGGTTCTGTTCGATGAG
CCTGATTTGGTCGAACTTTACGCCGGATTGGTTTGTGAAGATGCCAAGAAGCCTATGGATCCAGGTGTTGGCATTGGACCGACCTATACAATCAGTCGTAGCATTCTTTCTGACGCAGTT
ACATTGGTTCGTGGTGACAGATTTTATACCACCGACTATCATCCAGCAAACCTTACGAATTGGGGCGTCACCGAAGTCAAGTATGATTTAAACGTCAATCAAGGTTGCGTTTTCTACAAA
TTGTTCATCCGAGCTTTCCCAAATCATTTCTCGTATAATAGCATATATGCCCACTATCCTCTTACGATACCGTCTGAAAACAAAAAGATTATGGAGAAACTCGGCCGTGCAGATGATTAC
AGCTGGGACAAACCAGTCAAGGTTCCAGAACGAAAGAATATTGTCACCTTTGATGGAGTCAAGAGTGTTCTTACCAATGCAGAAGTGTTTGGCGTTGATAATTGGCGCAGAGGTCTTGCT
TACCTCATGGGAAAACCAG
GTGCTAATTTCATGTTGGCTGGTGATGGCGACTTCTTTGCAGAGCGTCGTAATCAAATGAAGGAATGTCTTTACCAAGACAAATGGCACGAGAGTGTCAAG
AACTACTACGAAAGTATTGTTCCAAGACTCCTCAAGAGATGGTCCTACAATATCGGTGGCACGACCAACCAGGTTGATGTCATTCGCGATATTGATAATTCCG
CTCATGTACACTTTGCC
GCCAATGTTTTCCACCTACCACTCAAGACCGAAGAGAATCCCAAAGGTGTATATACCGAGCATGAATTGTACATGGTGTTGGCTGTTATCTTCATCGTTATATTTTTTGGTGATGTCGAC
CCAGCCAAAACGTTTTCATTACGTGCTGCTGGTCTTCCGGTTACACAAGATCTTGGTCAACTAGTTGAGCAAAACGTGAACTTTATCTCAAAGACTAGTCTTGTATCGGGTATCGTTGAT
ACTTTCATGGAAGAAAACAACGCACTTAAAGATTACGGTGTGCACATGGTGCGCCATTTGTTGAAGGCTGGCTTGGGCGTTCATGAGACTGT
TTGGTCACAAATTTTGCCAACAGCAGGA
GCAATGGTAGCAAACCAAGCACAAGTTTTTGGTCAAGTCCTCGACTTTTATCTTGGTGATGGCAAAGAGCATCTTCCGGAGATTAACCGTCTTGCAAAGCTCAACACAGCAGAAGCAGAT
GATATTCTCTTACATTACCTGTTGGAAGGAATTA
GAATGTACGGCACATTCGGTGCTTACCGAACATGTCATCAAAACATTACCATCAACGATGGATCTCGAAAAGTCGAGTGCAAGCCT
GGCGATTCAGTTTTCGTCAGTTTC
GTTTCACTAGCCCAGGACCCTAAAATCTATCCCGATCCAAAGACAGTTCGTCTAGATCGTCCAGTTGATTCTTACCTCGTGTATGGCGTCGGTTCC
CACGCTTGTCTCGGCGGTGAAGCTTCGCGTGTAGCTCTTACAGCCATGCTTAAATGCATTGGCCGACTTGACAATTTGAGAAGAGCATCTGGTCCTCAGGGTGAAATGAAGAAGGTTCCA
AGAGAAGGAGGATTCTATGTTTATATGGATAAGATGATGGGATCCGAATTCCCCTTCCCGACTACGATGAAGATTTGTTGGGATGGAGGGTTGAATGAACCGGTACCGGTGGTGGAGAAG
GGGAAAGGAAAGAAGAATGGCGCATGA

Retrieve as FASTA