Entry information : SsclLDS01
Entry ID 5856
Creation 2007-10-11 (Marcel Zamocky)
Last sequence changes 2007-10-11 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-04-27 (Catherine Mathe (Scipio))
Peroxidase information: SsclLDS01
Name SsclLDS01
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Ascomycota Leotiomycetes Sclerotiniaceae Sclerotinia
Organism Sclerotinia sclerotiorum    [TaxId: 5180 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SsclLDS01
start..stop
S start..stop
BfuLDS01 2219 0 73..1190 10..1127
CposLDS03_silveira 1300 0 102..1179 37..1111
CimLDS03 1293 0 102..1179 37..1111
AflLDS03 1242 0 56..1174 2..1118
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 450369..450459 91 N° 2 449672..450135 464 N° 3 449485..449624 140 N° 4 449032..449431 400
N° 5 448749..448984 236 N° 6 448609..448698 90 N° 7 447611..448557 947 N° 8 447355..447558 204
N° 9 446955..447303 349 N° 10 446726..446907 182 N° 11 446564..446673 110 N° 12 446147..446509 363
complement(join(446147..446509,446564..446673,446726..446907,446955..447303,4473 55..447558,447611..448557,448609..448698,448749..448984,449032..449431,449485..4 49624,449672..450135,450369..450459))


exon

Literature and cross-references SsclLDS01
Literature The Broad Institute Genome Sequencing Platform. Annotation of the Sclerotinia sclerotiorum 1980 genome.
Protein ref. GenBank:   XP_001588258.1 UniProtKB:   A7EZD8
DNA ref. JGI genome:   Supercontig_2.16 (450459..446147)
mRNA ref. GenBank:   XM_001588208
Protein sequence: SsclLDS01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1191
PWM (Da):   %s   132923.19  
PI (pH):   %s   6.95
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MYYPASIVAHGRSYQIEGRASLVPFLGGLLEYFIELTAMMRRLSTVFKTKDKENTKSSPTTAENGATSSSPTGRRLTMGVSKKSNSGAASSNPQAFDGPDHSVKRAGIVGTLESLGKVISTANRPLNTETGDGSYDTKQEQTGLLDDLKSLRIKDLETLQLTMKQELGTSKLTDDKSMLMERLILVANLPGTSKTRVKLTEVLVDELWGSLEHPPASMLGDKYNYRQADGSYNNIRFPDIGKAGTAYARSVTPKIVQPNPKPDPGLIFDTIMSRENGGFKPHPNNVSSMLYYIASIIIHDCFRTSHEDFNVSMTSSYLDLSPLYGSNQDEQNNMRTLKDGELKPDCFSEKRLLGFPPGVGCILMFNRFHNYVVKQLATINENGRFTPPKDNLPEDKKQAAWKKYDNDLFQTGRLITCGLYINIILLDYLRTIVGLNRVNSTWTLDPRIEMERNSKPGTVAGVGNQCAAEFNLVYRWHSCISQRDEKWSEDLYMKIFGKSHKEVSMQELLIGLGKLEAMTPDDPLQRDFAGMKRGSDGKLSDDDLVKELTASIEDLAGSSGANNVPAVLRAVEILGMEQARAWKCATLNEFRKHFGLIPHEKFSDINSDPAVYEKLKVIYDDPDLVELYAGLVCEDAKKPMDPGVGIGPTYTISRSILSDAVTLVRGDRFYTTDYHAANLTNWGITEVDYDLNVNQGCVFYKLFIRAFPNHFSFNSIYAHYPLTIPTENKKIMEKLGRVDDYSWEKPTRIPERKNVVTYDGVKSVLTNGEVFGVDNWRRGLAFLMGKGANFMLAGDGEFFAERRNQMKECLYQDKWQESVKNYYESIVPKLLKRWSYNIGGTTNQVDVIRDIDNSAHVYFASNIFHLPLKSEENPKGVYTEHELYMVLAVIFIVIFFGDVDPAKTFSLRAAGLPVTQDLGQLVEQNVNFISKTSLVSGIVDNFMQENNALKDYGVHMVRHLLKAGLGVHETVWSQILPTAGAMVANQAQVFGQVLDYYLGDGKEHLPEINRLAKLNTPEADDILLHYLLEGRMNGTFGAYRTCHQNITINDGSRKVECKPGDSVFTSVSLAQDPKIYPEPKKVRLDRPIDSYLVYGVGPHACLGGDASRVALTAMLKCIGRLDNLRRAPGPQGEMKKIPREGGFYVYMDKMMGSEFPFPTTMKICWDGGLNEPEAVGDKGKGKKMGL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (11 introns). Strain="1980". Regions: 226-689 peroxidase domain; 757-1148 "cypX" cytochrome P450 domain.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTACTATCCTGCATCAATCGTAGCACACGGCAGAAGCTATCAAATCGAGGGGAGAGCTTCCCTTGTCCCTTTCCTCGGCGGCTTACTAGGTAGCTCAGCTTCTCATCCTTTCCGACCT
CTTCCTTTTTCTTTCTCCTACATCACCACCACCTTTATATTCCAACAGTATCCCAATTGAATTGACCTCATGCGACAAAATTGTTTACTCTATTGTAACAATTGATCACTGATTTTCATG
TAAGCAATAAGTAACTCGATAAATTCTATATTACTTGTTAAATGCAATTTGTATTTTCGTTTAAGAACTAACAGTCTAGCATAGAATACTTCATCGAGTTAACCGCAATGATGAGACGTC
TTTCGACAGTGTTCAAGACTAAGGACAAGGAGAACACCAAATCTTCACCCACAACTGCCGAAAATGGGGCGACTTCCTCGAGCCCAACGGGACGTCGTTTGACGATGGGTGTGTCTAAAA
AGTCCAACAGTGGTGCTGCAAGCTCTAATCCCCAAGCATTTGACGGTCCCGATCATAGTGTAAAACGCGCTGGTATTGTGGGAACTCTTGAATCACTTGGGAAAGTCATCAGCACAGCCA
ACCGTCCTTTAAATACCGAAACTGGAGATGGCTCCTATGACACAAAACAGGAACAGACGGGTTTATTGGATGATCTCAAATCATTAAGAATCAAGGATTTGGAAACATTGCAGTTGACCA
TGAAGCAAGAATTGGGAACCTCAAAATTGACGGACGACAAGAGCATGCTAATGGAAAGGCTCATCCAG
GTAAACTTGGGCCTTAATTTGTTCACACAAAAGCTAATACTAAAAAGTTGGT
TGCAAATCTTCCTGGAACTTCCAAGACTCGGGTCAAGCTTACCGAAGTACTGGTTGATGAATTATGGGGCTCTTTGGAACATCCACCAGCTTCAATGCTTGGTGACAAGTACAATTATCG
ACAAGCTGATGGCTC
GTGAGTGTATTACGAGAACTATCAACACCTTTCTCACTAATCCTTGTCCTTAGATATAATAACATCAGGTTTCCCGATATTGGAAAAGCAGGTACAGCTTACGCC
CGAAGTGTCACTCCCAAGATCGTTCAGCCAAACCCAAAACCAGATCCGGGTCTTATATTCGACACGATCATGAGTCGAGAGAATGGTGGTTTCAAGCCTCATCCAAACAATGTCTCCAGT
ATGCTTTACTACATTGCAAGTATTATCATTCATGACTGCTTTCGCACGTCACACGAAGATTTTAATGTTTCAATGACCTCCTCTTATTTGGATCTTTCTCCTTTATATGGAAGCAACCAG
GATGAGCAGAATAATATGCGAACTCTTAAGGATGGAGAGCTTAAGCCGGATTGTTTCTCCGAAAAGAGATTATTAGGCTTCCCTCCAGGAGTTGGATGCATCCTTATC
GTGAGTGACTCG
CTGAAGATTACAGGCCAGGAACTAAAACTGTGTAGATGTTCAACCGTTTTCATAACTATGTGGTCAAACAATTGGCAACAATCAATGAGAATGGACGCTTTACACCCCCCAAGGATAATC
TACCTGAGGATAAAAAGCAAGCAGCCTGGAAGAAATACGACAATGACCTCTTCCAGACTGGACGTCTTATTACTTGCGGCCTCTACATCAACATTATTCTGCTCGATTATCTACGCACAA
TTGTTGGATTGAATAGGGTCAATTCTACCTG
GTCAGTATCATTTATATAGGTAGGAAATGTTTTTGACTAATCGACATTAGGACTCTCGATCCTCGTATCGAAATGGAAAGAAATAGCAA
GCCGGGAACCGTTGCTGGAGTCGGTAATCAATGTGCTGCTGAATTCAATCT
GTAAGCTTTTTCAGCATCTGTCTTTTTGTACTTAGAGCTGATTCTTTATAGCGTATACCGATGGCATTC
CTGCATTAGTCAACGCGACGAGAAGTGGTCCGAAGATTTGTACATGAAAATCTTTGGGAAGAGCCACAAGGAAGTTTCTATGCAGGAACTCCTCATTGGCTTGGGTAAGCTTGAAGCAAT
GACTCCAGACGATCCTCTACAAAGAGACTTTGCTGGTATGAAGAGAGGTAGCGATGGGAAGCTCAGTGATGATGATCTCGTTAAGGAATTGACTGCGAGCATCGAAGATTTGGCTGGGTC
ATCAGGAGCGAATAACGTTCCTGCAGTACTTCGTGCTGTTGAAATCCTCGGGATGGAGCAAGCTCGTGCATGGAAGTGTGCAACTCTAAACGAATTCCGGAAACACTTTGGTCTCATACC
ACATGAAAAGTTCTCAGATATCAACTCGGATCCAGCGGTCTATGAGAAATTGAAGGTTATATACGATGATCCAGATTTGGTCGAACTTTACGCTGGATTGGTTTGTGAGGATGCTAAGAA
GCCGATGGATCCAGGTGTTGGTATCGGACCAACCTACACAATCAGTCGAAGTATTCTTTCTGACGCAGTGACACTGGTTCGTGGAGACAGATTTTATACTACCGACTATCATGCAGCAAA
TCTCACGAACTGGGGAATTACTGAAGTCGATTATGATTTGAACGTCAACCAAGGCTGCGTATTTTACAAACTATTCATTCGAGCTTTCCCCAATCACTTCTCATTTAACAGTATCTATGC
TCATTACCCTCTAACAATCCCGACGGAAAACAAGAAGATCATGGAGAAACTTGGTCGCGTAGATGACTATAGCTGGGAGAAACCAACAAGGATTCCCGAGAGAAAGAATGTTGTCACTTA
TGATGGAGTCAAGAGTGTTCTCACTAATGGAGAAGTATTTGGTGTTGACAACTGGCGCAGAGGTCTCGCTTTTCTCATGGGAAAACCAG
GTATTTAAAATTGTTTCAGAAGCCATACAAT
CCAATACTAATATAATCTTAGGGGCCAATTTTATGTTGGCTGGTGATGGCGAGTTCTTTGCCGAGCGACGCAACCAAATGAAGGAATGCCTCTACCAAGATAAATGGCAAGAAAGTGTGA
AGAACTATTACGAAAGTATTGTCCCAAAACTTCTCAAGAGATGGTCTTATAATATTGGAGGCACAACTAACCAGGTTGATGTCATTCGCGATATTGATAATTCCG
GTGAGTTACACGTTC
ATTCTAACGCAGTCATTTTTATCTAACATAAACTAGCTCATGTTTACTTTGCCTCGAACATCTTCCACCTTCCCCTCAAAAGTGAAGAGAATCCTAAAGGCGTATATACCGAGCATGAGT
TGTATATGGTTTTAGCCGTTATCTTCATTGTAATATTTTTCGGTGATGTCGATCCAGCGAAAACCTTCTCATTACGTGCCGCTGGTCTTCCAGTTACACAAGATCTCGGTCAACTAGTCG
AGCAGAATGTGAACTTTATTTCAAAGACAAGCCTCGTATCAGGTATTGTTGATAATTTCATGCAGGAAAATAATGCCCTCAAAGATTATGGTGTACACATGGTGCGCCATTTGTTGAAGG
CTGGTTTGGGTGTTCATGAGACTGT
GTTAGTAGTTCTTTTAATCACTCACTATTTTTACTGACATTGCATAGATGGTCACAAATTTTGCCTACAGCAGGAGCCATGGTGGCGAACCAAGC
ACAAGTTTTTGGTCAAGTACTCGACTATTATCTTGGTGATGGAAAGGAGCATCTTCCAGAAATTAATCGTCTTGCGAAGCTCAATACGCCTGAAGCAGATGATATCCTCTTACATTACCT
TCTGGAAGGAATCA
GTGAGCAATAGATTCAAATTTTCTCATTCAAACTAGTGCTAACAATGTCAAGGAATGAACGGCACATTTGGTGCTTATCGCACATGTCATCAAAATATCACCATCA
ACGACGGATCACGAAAAGTCGAATGCAAGCCCGGTGACTCTGTCTTCACAAGTTTT
GTATGTGTCTCCTTTCCAATACCTACGCACCTAAAAATCTCTAACAAATTCCAGGTCTCCCTAG
CCCAAGATCCCAAAATCTACCCCGAACCCAAGAAAGTCCGTCTAGACCGACCAATCGACTCTTACCTCGTCTACGGCGTCGGTCCACACGCTTGTCTCGGTGGCGACGCTTCACGCGTCG
CTCTCACCGCTATGCTCAAATGTATCGGACGACTCGACAATCTTCGCAGAGCACCAGGTCCTCAGGGTGAAATGAAGAAAATCCCTCGAGAAGGTGGTTTTTATGTTTACATGGATAAGA
TGATGGGCTCGGAATTCCCATTCCCGACTACTATGAAGATTTGTTGGGATGGGGGGTTGAATGAACCGGAGGCAGTGGGGGATAAGGGGAAGGGGAAGAAGATGGGTCTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTACTATCCTGCATCAATCGTAGCACACGGCAGAAGCTATCAAATCGAGGGGAGAGCTTCCCTTGTCCCTTTCCTCGGCGGCTTACTAGAATACTTCATCGAGTTAACCGCAATGATG
AGACGTCTTTCGACAGTGTTCAAGACTAAGGACAAGGAGAACACCAAATCTTCACCCACAACTGCCGAAAATGGGGCGACTTCCTCGAGCCCAACGGGACGTCGTTTGACGATGGGTGTG
TCTAAAAAGTCCAACAGTGGTGCTGCAAGCTCTAATCCCCAAGCATTTGACGGTCCCGATCATAGTGTAAAACGCGCTGGTATTGTGGGAACTCTTGAATCACTTGGGAAAGTCATCAGC
ACAGCCAACCGTCCTTTAAATACCGAAACTGGAGATGGCTCCTATGACACAAAACAGGAACAGACGGGTTTATTGGATGATCTCAAATCATTAAGAATCAAGGATTTGGAAACATTGCAG
TTGACCATGAAGCAAGAATTGGGAACCTCAAAATTGACGGACGACAAGAGCATGCTAATGGAAAGGCTCATCCAG
TTGGTTGCAAATCTTCCTGGAACTTCCAAGACTCGGGTCAAGCTT
ACCGAAGTACTGGTTGATGAATTATGGGGCTCTTTGGAACATCCACCAGCTTCAATGCTTGGTGACAAGTACAATTATCGACAAGCTGATGGCTC
ATATAATAACATCAGGTTTCCCGAT
ATTGGAAAAGCAGGTACAGCTTACGCCCGAAGTGTCACTCCCAAGATCGTTCAGCCAAACCCAAAACCAGATCCGGGTCTTATATTCGACACGATCATGAGTCGAGAGAATGGTGGTTTC
AAGCCTCATCCAAACAATGTCTCCAGTATGCTTTACTACATTGCAAGTATTATCATTCATGACTGCTTTCGCACGTCACACGAAGATTTTAATGTTTCAATGACCTCCTCTTATTTGGAT
CTTTCTCCTTTATATGGAAGCAACCAGGATGAGCAGAATAATATGCGAACTCTTAAGGATGGAGAGCTTAAGCCGGATTGTTTCTCCGAAAAGAGATTATTAGGCTTCCCTCCAGGAGTT
GGATGCATCCTTATC
ATGTTCAACCGTTTTCATAACTATGTGGTCAAACAATTGGCAACAATCAATGAGAATGGACGCTTTACACCCCCCAAGGATAATCTACCTGAGGATAAAAAGCAA
GCAGCCTGGAAGAAATACGACAATGACCTCTTCCAGACTGGACGTCTTATTACTTGCGGCCTCTACATCAACATTATTCTGCTCGATTATCTACGCACAATTGTTGGATTGAATAGGGTC
AATTCTACCTG
GACTCTCGATCCTCGTATCGAAATGGAAAGAAATAGCAAGCCGGGAACCGTTGCTGGAGTCGGTAATCAATGTGCTGCTGAATTCAATCTCGTATACCGATGGCATTCC
TGCATTAGTCAACGCGACGAGAAGTGGTCCGAAGATTTGTACATGAAAATCTTTGGGAAGAGCCACAAGGAAGTTTCTATGCAGGAACTCCTCATTGGCTTGGGTAAGCTTGAAGCAATG
ACTCCAGACGATCCTCTACAAAGAGACTTTGCTGGTATGAAGAGAGGTAGCGATGGGAAGCTCAGTGATGATGATCTCGTTAAGGAATTGACTGCGAGCATCGAAGATTTGGCTGGGTCA
TCAGGAGCGAATAACGTTCCTGCAGTACTTCGTGCTGTTGAAATCCTCGGGATGGAGCAAGCTCGTGCATGGAAGTGTGCAACTCTAAACGAATTCCGGAAACACTTTGGTCTCATACCA
CATGAAAAGTTCTCAGATATCAACTCGGATCCAGCGGTCTATGAGAAATTGAAGGTTATATACGATGATCCAGATTTGGTCGAACTTTACGCTGGATTGGTTTGTGAGGATGCTAAGAAG
CCGATGGATCCAGGTGTTGGTATCGGACCAACCTACACAATCAGTCGAAGTATTCTTTCTGACGCAGTGACACTGGTTCGTGGAGACAGATTTTATACTACCGACTATCATGCAGCAAAT
CTCACGAACTGGGGAATTACTGAAGTCGATTATGATTTGAACGTCAACCAAGGCTGCGTATTTTACAAACTATTCATTCGAGCTTTCCCCAATCACTTCTCATTTAACAGTATCTATGCT
CATTACCCTCTAACAATCCCGACGGAAAACAAGAAGATCATGGAGAAACTTGGTCGCGTAGATGACTATAGCTGGGAGAAACCAACAAGGATTCCCGAGAGAAAGAATGTTGTCACTTAT
GATGGAGTCAAGAGTGTTCTCACTAATGGAGAAGTATTTGGTGTTGACAACTGGCGCAGAGGTCTCGCTTTTCTCATGGGAAAACCAG
GGGCCAATTTTATGTTGGCTGGTGATGGCGAG
TTCTTTGCCGAGCGACGCAACCAAATGAAGGAATGCCTCTACCAAGATAAATGGCAAGAAAGTGTGAAGAACTATTACGAAAGTATTGTCCCAAAACTTCTCAAGAGATGGTCTTATAAT
ATTGGAGGCACAACTAACCAGGTTGATGTCATTCGCGATATTGATAATTCCG
CTCATGTTTACTTTGCCTCGAACATCTTCCACCTTCCCCTCAAAAGTGAAGAGAATCCTAAAGGCGTA
TATACCGAGCATGAGTTGTATATGGTTTTAGCCGTTATCTTCATTGTAATATTTTTCGGTGATGTCGATCCAGCGAAAACCTTCTCATTACGTGCCGCTGGTCTTCCAGTTACACAAGAT
CTCGGTCAACTAGTCGAGCAGAATGTGAACTTTATTTCAAAGACAAGCCTCGTATCAGGTATTGTTGATAATTTCATGCAGGAAAATAATGCCCTCAAAGATTATGGTGTACACATGGTG
CGCCATTTGTTGAAGGCTGGTTTGGGTGTTCATGAGACTGT
ATGGTCACAAATTTTGCCTACAGCAGGAGCCATGGTGGCGAACCAAGCACAAGTTTTTGGTCAAGTACTCGACTATTAT
CTTGGTGATGGAAAGGAGCATCTTCCAGAAATTAATCGTCTTGCGAAGCTCAATACGCCTGAAGCAGATGATATCCTCTTACATTACCTTCTGGAAGGAATCA
GAATGAACGGCACATTT
GGTGCTTATCGCACATGTCATCAAAATATCACCATCAACGACGGATCACGAAAAGTCGAATGCAAGCCCGGTGACTCTGTCTTCACAAGTTTT
GTCTCCCTAGCCCAAGATCCCAAAATC
TACCCCGAACCCAAGAAAGTCCGTCTAGACCGACCAATCGACTCTTACCTCGTCTACGGCGTCGGTCCACACGCTTGTCTCGGTGGCGACGCTTCACGCGTCGCTCTCACCGCTATGCTC
AAATGTATCGGACGACTCGACAATCTTCGCAGAGCACCAGGTCCTCAGGGTGAAATGAAGAAAATCCCTCGAGAAGGTGGTTTTTATGTTTACATGGATAAGATGATGGGCTCGGAATTC
CCATTCCCGACTACTATGAAGATTTGTTGGGATGGGGGGTTGAATGAACCGGAGGCAGTGGGGGATAAGGGGAAGGGGAAGAAGATGGGTCTTTGA

Retrieve as FASTA