Entry information : CcinDyPrx02
Entry ID 5866
Creation 2007-10-19 (Christophe Dunand)
Last sequence changes 2007-10-19 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-08-13 (Marie Brette (Scipio))
Peroxidase information: CcinDyPrx02
Name CcinDyPrx02
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Psathyrellaceae Coprinopsis
Organism Coprinopsis cinerea (Coprinus cinereus)    [TaxId: 5346 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CcinDyPrx02
start..stop
S start..stop
BaDyPrx08 605 0 53..648 2..570
PcarDyPrx 585 0 74..648 11..561
BaDyPrx10 562 0 133..648 40..560
GluxDyPrx10 384 5e-127 179..642 68..518
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 959859..959942 84 N° 2 959541..959804 264 N° 3 959434..959487 54 N° 4 959325..959383 59
N° 5 959175..959276 102 N° 6 958294..959123 830 N° 7 958056..958236 181 N° 8 957857..957996 140
N° 9 957568..957800 233  
complement(join(957568..957800,957857..957996,958056..958236,958294..959123,9591 75..959276,959325..959383,959434..959487,959541..959804,959859..959942))


exon

Literature and cross-references CcinDyPrx02
Literature Birren et al., Whitehead Institute/MIT Center for Genome Research.
DNA ref. JGI genome:   Chr_9 (959942..957571)
Protein sequence: CcinDyPrx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   648
PWM (Da):   %s   72530.81  
PI (pH):   %s   6.11
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTRPTLTNINGASFTVVVPPGWFTTVSAISRRTYNQLVTCAYKVEGDTRAEYLANQWGNPNQAMRDTTSSMDSIAIIPQDETVTMDFSVYHHTRSNVSGEDLESPKYRSNRINVLTSEKPANAPQGFPDYVTFAVMVEDGSVALPPSSPEYDDVVIAINVMEGGANPGGDPKPKPSPYNLPNIQGDILPAMPKALEHFYYFRITNLPVFRKVMKDFVIPKITTADKLVNDPPPPINPRDPNSFKYPWLGVNVGFTHLAMRMFGLSDNLGDIAYEKGQQQDSKELGDAGTQRGNFWTPSWDGAFKEDIHGIFLIVAYNNDVAQKFIDELEAAFKYTPSRSAIHKVVKIHGFPRPEPEDRNDHFGYRGGMSNPQVAGVTFKDKMRYPGSPLIPMGVIVMGYDGDEDKDKRPAWAKDGAFMVTRKLNNLVPEFDDFLLQHGPRIFPELKPQEAADKLGARLFGRWKGTPTELSPDHNDPDIAKDDNRINNFTFDQSKGQSRCPFASHMRKSNPRNDVSPVESAFKHFVRRHNMPYGPEITDEEKDGNGTIYERGLHVVCYQSSIVRGFKFIQGWYNDPNFPPNKPVTPGLDPIFGQTGKEEEGDHRSMSGANPTLEQEIMTFPHKFIDPRGGEYFFSPSISTLKTYIAA

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns). Strain="okayama7#130".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGAGACCGACGCTTACGAACATCAATGGTGCCTCCTTCACGGTGGTCGTTCCACCAGGATGGTTCACTACTGTCAGCGCGGTGCGTGGAAAGTGCTCTCGATTCTCGTAGATTGAC
ATTAACATTCCGCTATAGATTAGCAGGCGCACTTACAATCAGCTTGTTACCTGTGCTTACAAGGTCGAAGGAGACACCAGGGCCGAGTACCTTGCTAACCAATGGGGCAACCCCAACCAG
GCAATGCGCGATACCACGTCCTCTATGGATTCTATCGCTATCATTCCTCAGGATGAGACAGTGACCATGGACTTCAGCGTCTACCACCACACCAGGTCTAATGTCTCTGGCGAGGACTTG
GAAAGCCCGAAGTATAGAAGCAACAGGATCAACGTCCTTACT
GTAAGCGCTGGGTTACTCTTCTTCGTCCCTGACCATCTCATCACAATCCATAGTCTGAGAAACCGGCCAACGCTCCCC
AAGGTTTCCCTGACTATGTCACATTTGCA
GTACGTTAACACGCTATCCCGACTCCTCCGAGTTACTAACCACTGCTCAGGTGATGGTTGAGGATGGCTCGGTCGCTCTTCCTCCCAGTAG
TCCCGAATATGACGACGT
GTAAGTCACCTCTCTCGAAGTTGCATATCGTCACTCACTGTACGGTAGTGTCATCGCTATCAACGTCATGGAAGGCGGAGCCAACCCTGGCGGGGATCCCAA
GCCAAAGCCGTCTCCCTACAACCTCCCCAACATTCAAGGCGATATTCT
GTAGGTATTTGGACCTAACCTAGAATCGTCTTTTTCTTACTCTCCTATCAGACCTGCAATGCCAAAGGCGTT
GGAACACTTCTACTACTTCCGCATTACCAACCTACCCGTTTTCAGGAAGGTCATGAAGGACTTCGTCATCCCCAAGATCACCACTGCGGATAAACTGGTGAACGACCCACCCCCACCTAT
CAATCCCAGGGACCCCAATAGCTTCAAATACCCGTGGCTGGGTGTCAATGTCGGCTTCACTCATCTCGCCATGAGGATGTTCGGCTTGAGCGACAACCTCGGCGATATCGCCTACGAGAA
AGGTCAACAACAAGACTCGAAGGAACTCGGCGATGCAGGTACCCAGCGCGGCAACTTCTGGACTCCCAGCTGGGATGGTGCCTTCAAGGAAGATATCCACGGCATCTTCCTTATCGTTGC
TTACAACAACGACGTAGCCCAGAAATTCATCGACGAGCTGGAGGCTGCGTTCAAGTACACGCCTTCGAGATCTGCCATCCACAAGGTGGTCAAGATCCACGGGTTCCCTCGTCCAGAGCC
GGAGGATCGAAACGATCACTTTGGTTATCGAGGCGGGATGTCCAACCCCCAGGTCGCTGGCGTTACGTTCAAGGACAAAATGAGGTATCCTGGCTCCCCTCTCATTCCCATGGGTGTCAT
CGTCATGGGATACGACGGTGACGAGGACAAGGACAAGCGACCCGCCTGGGCCAAGGACGGCGCCTTCATGGTCACCCGCAAGTTAAACAACCTCGTCCCCGAATTTGACGACTTCCTATT
GCAACATGGGCCCAGGATCTTCCCCGAGCTTAAGCCTCAAGAGGCTGCGGATAAGCTCGGTGCTCGCCTCTTTGGCCGGTGGAAGAATG
GTGAGTACGACAGCCCCGGGATTGAGAACGA
TGATGTCTGACGGGTGTCCTTCGCAGGCACGCCGACTGAGCTTTCCCCTGACCACAATGACCCTGACATCGCCAAGGATGATAACAGGATTAATAACTTTACCTTTGATCAATCCAAAGG
TCAATCTCGGTGCCCATTCGCCTCTCATATGCGCAAGTCCAACCCGCGTAACGACGTGTCTCCTGTGGAATCTGCGTTCAAGCACTT
GTAAGTCTTTGTCTGGCCTTTCTAATCGTCAGG
AAAGCGAAGCTAATCACGCTCTTTAGCGTTCGCCGTCATAACATGCCATACGGCCCTGAAATCACCGATGAAGAAAAGGACGGGAACGGCACCATTTACGAGCGCGGTCTTCATGTCGTC
TGCTACCAAAGCAGCATTGTCCGAGGCTTCAAGTTCATTCAAGAGG
GTACGTTGCTTTCATTCTCCGTTCGACTCGGCCAAGTGCCTAACCGCCCTTGACAGGCTGGTACAACGACCCCA
ACTTCCCGCCCAACAAACCCGTCACCCCAGGTCTCGATCCCATCTTTGGCCAAACTGGCAAGGAAGAAGAGGGCGACCATCGTTCCATGAGCGGTGCAAACCCGACTCTGGAGCAGGAAA
TTATGACTTTCCCTCACAAGTTCATTGATCCTCGTGGGGGAGAGTATTTCTTCTCGCCTTCGATTTCGACTTTGAAGACGTATATCGCTGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGAGACCGACGCTTACGAACATCAATGGTGCCTCCTTCACGGTGGTCGTTCCACCAGGATGGTTCACTACTGTCAGCGCGATTAGCAGGCGCACTTACAATCAGCTTGTTACCTGT
GCTTACAAGGTCGAAGGAGACACCAGGGCCGAGTACCTTGCTAACCAATGGGGCAACCCCAACCAGGCAATGCGCGATACCACGTCCTCTATGGATTCTATCGCTATCATTCCTCAGGAT
GAGACAGTGACCATGGACTTCAGCGTCTACCACCACACCAGGTCTAATGTCTCTGGCGAGGACTTGGAAAGCCCGAAGTATAGAAGCAACAGGATCAACGTCCTTACT
TCTGAGAAACCG
GCCAACGCTCCCCAAGGTTTCCCTGACTATGTCACATTTGCA
GTGATGGTTGAGGATGGCTCGGTCGCTCTTCCTCCCAGTAGTCCCGAATATGACGACGTTGTCATCGCTATCAACGTC
ATGGAAGGCGGAGCCAACCCTGGCGGGGATCCCAAGCCAAAGCCGTCTCCCTACAACCTCCCCAACATTCAAGGCGATATTCT
ACCTGCAATGCCAAAGGCGTTGGAACACTTCTACTAC
TTCCGCATTACCAACCTACCCGTTTTCAGGAAGGTCATGAAGGACTTCGTCATCCCCAAGATCACCACTGCGGATAAACTGGTGAACGACCCACCCCCACCTATCAATCCCAGGGACCCC
AATAGCTTCAAATACCCGTGGCTGGGTGTCAATGTCGGCTTCACTCATCTCGCCATGAGGATGTTCGGCTTGAGCGACAACCTCGGCGATATCGCCTACGAGAAAGGTCAACAACAAGAC
TCGAAGGAACTCGGCGATGCAGGTACCCAGCGCGGCAACTTCTGGACTCCCAGCTGGGATGGTGCCTTCAAGGAAGATATCCACGGCATCTTCCTTATCGTTGCTTACAACAACGACGTA
GCCCAGAAATTCATCGACGAGCTGGAGGCTGCGTTCAAGTACACGCCTTCGAGATCTGCCATCCACAAGGTGGTCAAGATCCACGGGTTCCCTCGTCCAGAGCCGGAGGATCGAAACGAT
CACTTTGGTTATCGAGGCGGGATGTCCAACCCCCAGGTCGCTGGCGTTACGTTCAAGGACAAAATGAGGTATCCTGGCTCCCCTCTCATTCCCATGGGTGTCATCGTCATGGGATACGAC
GGTGACGAGGACAAGGACAAGCGACCCGCCTGGGCCAAGGACGGCGCCTTCATGGTCACCCGCAAGTTAAACAACCTCGTCCCCGAATTTGACGACTTCCTATTGCAACATGGGCCCAGG
ATCTTCCCCGAGCTTAAGCCTCAAGAGGCTGCGGATAAGCTCGGTGCTCGCCTCTTTGGCCGGTGGAAGAATG
GCACGCCGACTGAGCTTTCCCCTGACCACAATGACCCTGACATCGCC
AAGGATGATAACAGGATTAATAACTTTACCTTTGATCAATCCAAAGGTCAATCTCGGTGCCCATTCGCCTCTCATATGCGCAAGTCCAACCCGCGTAACGACGTGTCTCCTGTGGAATCT
GCGTTCAAGCACTT
CGTTCGCCGTCATAACATGCCATACGGCCCTGAAATCACCGATGAAGAAAAGGACGGGAACGGCACCATTTACGAGCGCGGTCTTCATGTCGTCTGCTACCAAAGC
AGCATTGTCCGAGGCTTCAAGTTCATTCAAGAGG
GCTGGTACAACGACCCCAACTTCCCGCCCAACAAACCCGTCACCCCAGGTCTCGATCCCATCTTTGGCCAAACTGGCAAGGAAGAA
GAGGGCGACCATCGTTCCATGAGCGGTGCAAACCCGACTCTGGAGCAGGAAATTATGACTTTCCCTCACAAGTTCATTGATCCTCGTGGGGGAGAGTATTTCTTCTCGCCTTCGATTTCG
ACTTTGAAGACGTATATCGCTGCTTGA

Retrieve as FASTA