Entry information : SbPrx131 ( Sobic.010G128700.1 [2.1] / Sb10g011530 [1.4])
Entry ID 588
Creation 2005-12-16 (Christophe Dunand)
Last sequence changes 2011-01-18 (Toky Ramarohetra (Scipio))
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx131 ( Sobic.010G128700.1 [2.1] / Sb10g011530 [1.4])
Name (synonym) SbPrx131 ( Sobic.010G128700.1 [2.1] / Sb10g011530 [1.4])
Class Class III peroxidase    [Orthogroup: Prx052]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue types Callus
Roots
Seedlings
Inducers Acid treatment
Alkaline treatment
Phosphate starvation
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx131
start..stop
S start..stop
SbPrx145 570 0 23..331 21..329
SiPrx30 564 0 23..331 21..329
SbPrx129 561 0 1..331 5..332
SbPrx130 558 0 23..331 30..339
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 16855930..16856157 228 N° 2 16856248..16857015 768  
join(16855930..16856157,16856248..16857015)


exon

Literature and cross-references SbPrx131 ( Sobic.010G128700.1 [2.1] / Sb10g011530 [1.4])
Literature Cordonnier-Pratt,et al
An EST database from Sorghum: acid- and alkaline-treated roots
DNA ref. Phytozome 12:   chromosome_10 (16855930..16857015)
Cluster/Prediction ref. PlantGDB:   SbGSStuc11-12-04.5406.1
Protein sequence: SbPrx131 ( Sobic.010G128700.1 [2.1] / Sb10g011530 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (302)
PWM (Da):   %s   35364.04 (32378.4) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.61 (8.70) Peptide Signal:   %s   cut: 30 range:30-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEFKSCLVPLLLPTMALLLLAFGSSPAAAQLQVGYYSKTCPNVEAIVRNETAKIIGAAPSLAGPLLRLHFHDCFVRGCDASVLLESNGGNKAEKDAKPNKSLRGFGSVERVKAKLEAACPNTVSCADVLTLMARDAVVLARGPSWPVALGRRDGRVSSATEAADHLPPAFGDVPLLTKIFAANGLDVKDLAVLSGGHTLGTAHCGSYAGRLYNFSSGYSADPSLDSEYAHRLRTRCKSADDKATLSEMDPGSYKTFDTSYYRQVAKRRGLFQSDAALLADATTREYVQRIATGKFDDVFFKDFGESMIKMGNVGVLTGAQGEIRKKCYIVN*

Retrieve as FASTA  
Remarks Complete sequence from 5 ESTs and genomic (chromo 10, intron 1)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAATTCAAGTCTTGTCTAGTACCGCTGCTGCTCCCTACTATGGCCCTGCTGCTTCTCGCTTTTGGCAGCTCGCCCGCGGCGGCTCAGCTGCAAGTCGGCTACTACAGCAAGACATGC
CCGAACGTCGAGGCCATCGTCCGCAACGAGACGGCGAAGATCATCGGCGCTGCGCCCAGCCTCGCCGGTCCACTTCTCAGGCTCCATTTCCACGACTGCTTTGTCAGG
GTAGGTGTCGTC
GTCGCAGTAGCCAGATTTCAGTTGATCATTGTTATATGTACTTATGTAGCAGTACTTACAGAAACATCTGATTTCCAGGGTTGTGACGCCTCAGTCCTGCTGGAGTCCAACGGGGGCAAC
AAGGCCGAGAAGGACGCCAAGCCGAACAAGAGCCTGCGGGGCTTCGGTTCCGTGGAGAGAGTGAAGGCCAAGCTGGAAGCCGCCTGCCCCAACACGGTTTCCTGCGCGGACGTCCTCACC
CTCATGGCCCGCGACGCCGTCGTGCTCGCCAGGGGCCCTTCCTGGCCTGTCGCACTCGGTAGGCGAGACGGCAGGGTGTCGAGCGCCACGGAGGCGGCCGACCACCTGCCTCCTGCCTTC
GGGGACGTCCCGCTGCTCACCAAGATCTTCGCCGCCAATGGCCTCGACGTCAAGGACCTCGCTGTCCTCTCCGGCGGCCACACCCTCGGCACGGCGCACTGCGGGTCCTACGCCGGCCGG
CTATACAACTTCAGCAGCGGCTACAGCGCGGACCCATCCCTCGACAGCGAGTACGCCCACAGGCTCAGGACGCGCTGCAAGAGCGCCGACGACAAGGCCACGCTTTCCGAGATGGACCCC
GGCAGCTACAAGACCTTCGACACCAGCTACTACCGCCAGGTCGCGAAACGGAGGGGGCTCTTCCAGTCCGACGCCGCGCTCCTCGCAGACGCCACCACTAGGGAGTACGTCCAGCGCATT
GCCACCGGCAAGTTTGACGACGTGTTCTTCAAGGACTTCGGCGAGTCCATGATCAAGATGGGCAACGTTGGCGTGCTCACCGGTGCTCAGGGGGAGATCAGAAAGAAGTGCTACATCGTC
AACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAATTCAAGTCTTGTCTAGTACCGCTGCTGCTCCCTACTATGGCCCTGCTGCTTCTCGCTTTTGGCAGCTCGCCCGCGGCGGCTCAGCTGCAAGTCGGCTACTACAGCAAGACATGC
CCGAACGTCGAGGCCATCGTCCGCAACGAGACGGCGAAGATCATCGGCGCTGCGCCCAGCCTCGCCGGTCCACTTCTCAGGCTCCATTTCCACGACTGCTTTGTCAGG
GGTTGTGACGCC
TCAGTCCTGCTGGAGTCCAACGGGGGCAACAAGGCCGAGAAGGACGCCAAGCCGAACAAGAGCCTGCGGGGCTTCGGTTCCGTGGAGAGAGTGAAGGCCAAGCTGGAAGCCGCCTGCCCC
AACACGGTTTCCTGCGCGGACGTCCTCACCCTCATGGCCCGCGACGCCGTCGTGCTCGCCAGGGGCCCTTCCTGGCCTGTCGCACTCGGTAGGCGAGACGGCAGGGTGTCGAGCGCCACG
GAGGCGGCCGACCACCTGCCTCCTGCCTTCGGGGACGTCCCGCTGCTCACCAAGATCTTCGCCGCCAATGGCCTCGACGTCAAGGACCTCGCTGTCCTCTCCGGCGGCCACACCCTCGGC
ACGGCGCACTGCGGGTCCTACGCCGGCCGGCTATACAACTTCAGCAGCGGCTACAGCGCGGACCCATCCCTCGACAGCGAGTACGCCCACAGGCTCAGGACGCGCTGCAAGAGCGCCGAC
GACAAGGCCACGCTTTCCGAGATGGACCCCGGCAGCTACAAGACCTTCGACACCAGCTACTACCGCCAGGTCGCGAAACGGAGGGGGCTCTTCCAGTCCGACGCCGCGCTCCTCGCAGAC
GCCACCACTAGGGAGTACGTCCAGCGCATTGCCACCGGCAAGTTTGACGACGTGTTCTTCAAGGACTTCGGCGAGTCCATGATCAAGATGGGCAACGTTGGCGTGCTCACCGGTGCTCAG
GGGGAGATCAGAAAGAAGTGCTACATCGTCAACTAA

Retrieve as FASTA