Entry information : MtPrx01 (Rip1 / Medtr5g074860.1[4.0] / Medtr5g074860.1[3.5] / Medtr5g082780.1[3.0])
Entry ID 59
Creation 2006-09-06 (Christophe Dunand)
Last sequence changes 2010-09-14 (Haythem Mhadhbi)
Sequence status complete
Reviewer Bruno Savelli
Last annotation changes 2017-08-08 (Bruno Savelli)
Peroxidase information: MtPrx01 (Rip1 / Medtr5g074860.1[4.0] / Medtr5g074860.1[3.5] / Medtr5g082780.1[3.0])
Name (synonym) MtPrx01 (Rip1 / Medtr5g074860.1[4.0] / Medtr5g074860.1[3.5] / Medtr5g082780.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue types Immature seeds
Pods
Roots
Inducers Pathogen interaction
Phytophthora infection
Rhizobium inoculation
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx01
start..stop
S start..stop
GmPrx62 529 0 1..324 33..358
GmPrx120 516 0 11..324 6..322
PvPrx10 507 0 8..324 9..326
GmPrx70 497 3e-179 20..324 18..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 31799302..31799523 222 N° 2 31798223..31798417 195 N° 3 31797488..31798048 561  
complement(join(31797488..31798048,31798223..31798417,31799302..31799523))


exon

Literature and cross-references MtPrx01 (Rip1 / Medtr5g074860.1[4.0] / Medtr5g074860.1[3.5] / Medtr5g082780.1[3.0])
Literature Transient induction of a peroxidase gene in Medicago truncatula
precedes infection by Rhizobium meliloti. Plant Cell 7 (1), 43-55 (1995)
Protein ref. UniProtKB:   Q40372
DNA ref. Phytozome 11:   chr5 (31799523..31797488)
Cluster/Prediction ref. Phytozome Gene 11:   31090495 UniGene:   Mtr.12647
Omic ref. Gene atlas:   Mtr.25211.1.S1_at Legoo:   Mtr.25211.1.S1_at
Other ref. Medicago_jcvi:   23235
Protein sequence: MtPrx01 (Rip1 / Medtr5g074860.1[4.0] / Medtr5g074860.1[3.5] / Medtr5g082780.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (304)
PWM (Da):   %s   35503.44 (33262.3) Transmb domain:   %s   i7-29o
PI (pH):   %s   9.61 (9.74) Peptide Signal:   %s   cut: 22 range:22-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSSPCQIFLVFVMVTLVTSLIPSNALLTPHFYDNVCPQALPTIKSVVLHAILREKRIGASLLRLHFHDCFVNGCDGSVLLDDTPNFTGEKTALPNINSIRGFSVVDEIKAAVDKVCKGPVVSCADILATAARDSVAILGGPQFFYNVLLGRRDARTASKAAANANLPSPTFNFSQLISNFKSQGLNVKDLVALSGGHTIGFARCTTFRNRIYNETNIDPIFAASLRKTCPRNGGDNNLTPLDFTPTRVENTYYRDLLYKRGVLHSDQQLFKGQGSESDKLVQLYSKNTFAFASDFKTSLIKMGNIKPLTGRQGEIRLNCRRVR*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, introns 1 and 2), 26 ESTs. Transcript variant predicted by Phytozome (extra intron and lack of VALS).
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2

AAAAAATTTT TTGTAGTTGT GACCGCTGCT AGCTGATCGT A 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2

TTTTTTTTTT TTTTTTTTTT TTTTTTT 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTAGTTCTCCTTGTCAAATATTCCTTGTGTTTGTTATGGTCACTTTGGTCACATCATTAATCCCTAGCAACGCATTGCTCACTCCTCATTTTTATGATAATGTTTGCCCTCAA
GCATTACCAACCATAAAGTCAGTTGTTCTCCATGCAATTCTTAGGGAAAAACGCATTGGAGCATCTCTTCTACGCTTGCATTTTCATGACTGCTTCGTTAAT
GTAAGTTATAATATAAAT
ATTAGTTGATCATTCTTAATGCTCAATTAGCACGGGATATCCCTTAGTATTAACTTTATGGACTATCAATATTTTTTGTGATCGTGGTTTTATCTAACTTGAGAAATTAGTGTTTACAAG
ATTGCACATATATGATGCTTGATTTATACCTAAAAAAAACATAATTTTGAAGAGTTCCATGCATGTTGTAGAATACTAGAAGTGGTTATTATCCTTTGACTAAACATAATTTTAGTATAT
ATGTTTAAATATTTTCATTAATTTAAAAATTTACATTAAAACCATCTTCAATTGGTTTTAAGTGTGTACTTACACTTAAAATCAGTTCTTAAATTTTGTTCCACTAGAGTTCGCTAAGGG
ACATCCATACAATTTTTTAAATGAAGTTGGATGTCTCCATATTGACAATTTCAAACATTGAACTCAGATTTTTCATATAAATTTTATGGCCAAATGGAATCTTAATTATTTTATGCAGGG
CACAAACAAACAGAAATTTCAAGAACACATATGAAATTTAAAATTCTTACGAAAATGCTGTCTTACCTAATTATTGGCCGCTTGCTTCAGTTACTTTTTTCTATTAAAAACCTTAGTTTA
TTTTAATTTCAACTTCAAGAAAATTAAAATTTCAAATTTCCACATGCTAAGTATTTTAACAACAACTAAAGAGTATTTCTTAATTGTGTCTTGTGATCTTCAATATGGTCCAAAAATTGG
TAATCTAAGTAAGAACATTTTCTCATATAATAGAAATTACTAATTCAAATACACATTAATATTTTAAATATAAAGATAACACATGTGAACATGTCACATTTTTCAAAACATATTTAACTA
GTTTAATATCAATGATTGAATTTTAGGGTTGTGATGGATCAGTCCTGCTAGATGATACCCCAAATTTCACTGGGGAGAAGACAGCTCTTCCAAATATTAATTCAATCAGAGGATTTTCTG
TGGTTGATGAAATCAAAGCAGCTGTTGATAAAGTATGCAAAGGCCCTGTTGTATCTTGTGCTGATATTTTAGCCACAGCAGCTCGTGATTCTGTAGCCATA
GTAAGTGTTACACAAATTA
AATGAACACTTACGAATGTAACTAAATGCATTGGTGTCGTATTGGTGTATGATACCGACACATGTCAAACACAAAATATACCTTTAATTTAAAGCGTTAGGTTTCGGGCAAAATTTGAAA
AATTATACATAATGTTCTATTGTCACTTTTAACAGTTGGGAGGTCCACAATTTTTCTACAATGTGTTATTGGGAAGAAGAGATGCAAGAACAGCAAGCAAAGCAGCTGCAAATGCAAATC
TTCCATCTCCAACATTCAACTTCTCGCAGCTTATTTCCAATTTCAAATCACAAGGTTTAAATGTAAAAGACCTAGTAGCTCTTTCTGGTGGCCACACTATAGGGTTTGCTAGGTGCACTA
CATTTAGAAACAGAATTTACAATGAAACAAACATTGATCCTATTTTTGCAGCATCTTTAAGGAAGACATGTCCTAGAAATGGTGGAGACAACAATTTAACACCACTTGATTTCACTCCTA
CAAGAGTTGAAAATACATATTATAGAGATTTGCTATACAAAAGAGGTGTCCTTCATTCTGATCAACAATTGTTTAAGGGACAAGGTAGTGAAAGTGACAAATTGGTGCAGCTATATAGTA
AGAACACTTTTGCTTTTGCTAGTGATTTTAAGACTTCTTTGATCAAGATGGGGAACATCAAGCCTCTTACCGGGAGACAAGGCGAGATTCGACTCAATTGCAGAAGGGTCAGATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTAGTTCTCCTTGTCAAATATTCCTTGTGTTTGTTATGGTCACTTTGGTCACATCATTAATCCCTAGCAACGCATTGCTCACTCCTCATTTTTATGATAATGTTTGCCCTCAA
GCATTACCAACCATAAAGTCAGTTGTTCTCCATGCAATTCTTAGGGAAAAACGCATTGGAGCATCTCTTCTACGCTTGCATTTTCATGACTGCTTCGTTAAT
GGTTGTGATGGATCAGTC
CTGCTAGATGATACCCCAAATTTCACTGGGGAGAAGACAGCTCTTCCAAATATTAATTCAATCAGAGGATTTTCTGTGGTTGATGAAATCAAAGCAGCTGTTGATAAAGTATGCAAAGGC
CCTGTTGTATCTTGTGCTGATATTTTAGCCACAGCAGCTCGTGATTCTGTAGCCATA
TTGGGAGGTCCACAATTTTTCTACAATGTGTTATTGGGAAGAAGAGATGCAAGAACAGCAAGC
AAAGCAGCTGCAAATGCAAATCTTCCATCTCCAACATTCAACTTCTCGCAGCTTATTTCCAATTTCAAATCACAAGGTTTAAATGTAAAAGACCTAGTAGCTCTTTCTGGTGGCCACACT
ATAGGGTTTGCTAGGTGCACTACATTTAGAAACAGAATTTACAATGAAACAAACATTGATCCTATTTTTGCAGCATCTTTAAGGAAGACATGTCCTAGAAATGGTGGAGACAACAATTTA
ACACCACTTGATTTCACTCCTACAAGAGTTGAAAATACATATTATAGAGATTTGCTATACAAAAGAGGTGTCCTTCATTCTGATCAACAATTGTTTAAGGGACAAGGTAGTGAAAGTGAC
AAATTGGTGCAGCTATATAGTAAGAACACTTTTGCTTTTGCTAGTGATTTTAAGACTTCTTTGATCAAGATGGGGAACATCAAGCCTCTTACCGGGAGACAAGGCGAGATTCGACTCAAT
TGCAGAAGGGTCAGATAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGATATCCTA GCCAAAAGAA ACATCACATA ATGGCTTCTA GTTCTCCTTG TCAAATATTC CTTGTGTTTG TTATGGTCAC TTTGGTCACA TCATTAATCC CTAGCAACGC ATTGCTCACT  CCTCATTTTT ATGATAATGT TTGCCCTCAA GCATTACCAA CCATAAAGTC AGTTGTTCTC CATGCAATTC TTAGGGAAAA ACGCATTGGA GCATCTCTTC TACGCTTGCA TTTTCATGAC  TGCTTCGTTA ATGGTTGTGA TGGATCAGTC CTGCTAGATG ATACCCCAAA TTTCACTGGG GAGAAGACAG CTCTTCCAAA TATTAATTCA ATCAGAGGAT TTTCTGTGGT TGATGAAATC  AAAGCAGCTG TTGATAAAGT ATGCAAAGGC CCTGTTGTAT CTTGTGCTGA TATTTTAGCC ACAGCAGCTC GTGATTCTGT AGCCATATTG GGAGGTCCAC AATTTTTCTA CAATGTGTTA  TTGGGAAGAA GAGATGCAAG AACAGCAAGC AAAGCAGCTG CAAATGCAAA TCTTCCATCT CCAACATTCA ACTTCTCGCA GCTTATTTCC AATTTCAAAT CACAAGGTTT AAATGTAAAA  GACCTAGTAG CTCTTTCTGG TGGCCACACT ATAGGGTTTG CTAGGTGCAC TACATTTAGA AACAGAATTT ACAATGAAAC AAACATTGAT CCTATTTTTG CAGCATCTTT AAGGAAGACA  TGTCCTAGAA ATGGTGGAGA CAACAATTTA ACACCACTTG ATTTCACTCC TACAAGAGTT GAAAATACAT ATTATAGAGA TTTGCTATAC AAAAGAGGTG TCCTTCATTC TGATCAACAA  TTGTTTAAGG GACAAGGTAG TGAAAGTGAC AAATTGGTGC AGCTATATAG TAAGAACACT TTTGCTTTTG CTAGTGATTT TAAGACTTCT TTGATCAAGA TGGGGAACAT CAAGCCTCTT  ACCGGGAGAC AAGGCGAGAT TCGACTCAAT TGCAGAAGGG TCAGATAGAG TTGTGATGAT CTCTTCAATG GACTTACTTA TCTTGAGGGA TTAGTATTTA TTTTCAATTA AGAATAAGAA  ATACTCTTTT CAATTTTAAA TATAAGCAAA AAAATAGAAA TAAAAATGTA TCTTTTTGCT TATATTTAAG ATCAAAGAGA ATGTACCGAG AATTCGAAAA GAAAAAAGGG GTATGAGACA  CTTGATTGAG AAATCATATT ATATTAGTAT GCCTGGGTAT GTAATATTAT ATGTTGGAGT GACTTTGTAT TATTAAGTTA TAGGTTCAAA TGACATGGGA CCTGTCCAGG TCAAATTTGA 
AAGGT 

Retrieve as FASTA