Entry information : SsclLDS02
Entry ID 5937
Creation 2007-10-26 (Christophe Dunand)
Last sequence changes 2007-10-26 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-27 (Catherine Mathe (Scipio))
Peroxidase information: SsclLDS02
Name SsclLDS02
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Ascomycota Leotiomycetes Sclerotiniaceae Sclerotinia
Organism Sclerotinia sclerotiorum    [TaxId: 5180 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SsclLDS02
start..stop
S start..stop
AorLDS01 795 0 121..1143 48..1057
NfLDS01 787 0 121..1117 48..1037
AflLDS01 785 0 121..1088 48..1009
AclLDS01 786 0 106..1117 32..1037
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1509606..1510460 855 N° 2 1509317..1509540 224 N° 3 1508983..1509257 275 N° 4 1508391..1508922 532
N° 5 1507939..1508206 268 N° 6 1507070..1507852 783 N° 7 1506844..1506914 71 N° 8 1506280..1506669 390
N° 9 1505841..1505933 93 N° 10 1505628..1505679 52  
complement(join(1505628..1505679,1505841..1505933,1506280..1506669,1506844..1506 914,1507070..1507852,1507939..1508206,1508391..1508922,1508983..1509257,1509317. .1509540,1509606..1510460))


exon

Literature and cross-references SsclLDS02
Literature The Broad Institute Genome Sequencing Platform. Annotation of the Sclerotinia sclerotiorum 1980 genome.
Protein ref. UniProtKB:   A7E8M9
DNA ref. JGI genome:   Supercontig_2.2 (1510460..1505628)
Protein sequence: SsclLDS02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1180
PWM (Da):   %s   131453.8  
PI (pH):   %s   6.98
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDASNRKNGEVDDKAFVRNFGKRSVTGKNNLVTRYRDYFTGKFQGKFRKSDRLDQNSLPKENTKSKSEPVSTSQLQYQPQITTEIMSAESSSTQPVWTSDTSKTKPTIISDIESATHSIQAIFRDLKSITPEDANTLLQLFSSEIKGVQNDNTLLLEKTVQLLSSQPETSGIGKSLTASFVNTLWDALPHPPMRSLDKKYMYRDADGGNNNIRMPDLGRAGTAYAKNVNAVRMKKKDLPDPGELFDSLMRRGGIDGEEPFKGSPTGISSQLFYLATIIIHDLFLTDHEDMTKSKTSSYLDLSPLYGCNQEEQNAIRTFEDGKLKPDCFSSKRILGFPPGVGVFLIMFNRFHNYVVEMLAQINDNGRFTKPKPEAEKSAFDKYDNDLFQTGRLVTCGLYVNIVLKDYVRTILNLNRTTSKWDLDPRVEEAKNLLSNPAAEGVGNQVSAEFNIYRWHSAISQKDEEWTNAEYTRLFPNKSPADVTLPELLRGLYTMEAELPTDPSQRSFANLTRLPDGSYDEGSLASIFQSSVEDLSGAFGAANVPPIMRSIEILSIIQSRSWNMCTLNEFRSFVGLTPHKSFADINPDPIIAKRLKEFYGSPEDLELYPRVVVRKTKPPVVPGSGLCTGYNEVQFDTNIDDGAVLYKLVLRAFPNYFEGNSIYAHFPFTTPEVNREIQKSLGREGLYSWEVPKKKAELSSVQTWDECKGILEDSVNWVTWGPPISVLTSQESSDSSKTDSSPAVLPFCLAGDAPVNATSRSLIISSFYNLPTGHDHKNDKEHPDWSSALNQFYTDNTADLFEKHKVLIPTVSTSASTNETSTISKTYRVDIVSDICNRVFTRFAAGVFDIPLKLGMGNTVDVNITTDPEEGYTEEELYDSLSVAFICIFNNLDVTKSFAVDQQARAIAKKLGDILMERTKDGKIGEAFDGLKDKLHSLVFDDKTERHVEGWVQKEKERLALKGYGREMVERFIEGGKKSSNFSSNDGKSISASFSSYRLLPYFLEATRIHGNVALLRLYSPSQTTSQTPTSTSPSKSTTYTPGTVYLLNLPLAQHDPTAFPDPETVKLDRNLNSYLTFGQGRHECLGKNAALMGMLRVFRIIIGLKGLRLDVGKNGMVSGGMKSVGQGLELGTSTLLFPNISLTLTLTLTPSYLLSKSAKKRLDEKKKKKKKGFEESMK

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns). Strain="1980". Regions: 296-608 peroxidase domain; 1044-1096 "cypX" cytochrome P450 domain.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATGCTTCAAATAGGAAGAATGGGGAAGTGGATGATAAAGCTTTTGTAAGAAATTTTGGGAAGCGATCGGTAACGGGAAAAAATAACCTGGTAACAAGATACCGAGATTATTTTACT
GGAAAATTCCAAGGGAAATTTAGGAAAAGTGATCGCTTGGATCAGAACTCTTTACCAAAGGAGAATACCAAGTCGAAATCAGAGCCAGTTTCAACATCTCAATTACAATATCAACCACAA
ATCACAACCGAAATCATGTCTGCTGAATCATCCTCAACCCAGCCTGTCTGGACATCTGATACTTCCAAAACAAAACCAACAATCATTTCTGACATCGAATCTGCAACTCATAGCATCCAA
GCCATCTTCCGAGATCTCAAATCCATCACTCCAGAGGATGCAAATACTTTACTCCAACTCTTCTCTTCGGAGATCAAGGGTGTCCAAAATGACAATACGCTTCTTCTAGAAAAGACAGTA
CAATTGCTATCTTCTCAACCAGAAACTTCAGGAATTGGAAAAAGTCTAACAGCAAGTTTTGTGAATACTCTTTGGGATGCTCTACCGCATCCACCTATGAGGAGTTTGGATAAGAAATAT
ATGTATAGGGATGCAGATGGTGGGAATAATAATATTCGGATGCCCGATTTAGGGAGAGCGGGGACGGCTTATGCAAAGAATGTTAATGCTGTGAGAATGAAGAAGAAGGATTTACCTGAT
CCGGGAGAGCTTTTTGATAGTTTGATGAGGAGAGGTGGAATAGATGGAGAAGAGCCGTTTAAAGGGAGTCCGACGGGTATCAGTAGTCAGTTGTTTTATTTGGCTACGATTATTATTCAT
GATCTCTTTCTTACG
GTAGGTGCAATTCGTCGATGCTTAGTATTGTCAGAGGAATTCAAGAAGCTAATGACTAGAGATAGGATCATGAAGATATGACTAAGTCCAAGACGAGTAGTTATT
TGGATCTCTCACCTCTCTATGGCTGCAATCAAGAAGAGCAAAATGCAATTCGAACATTTGAAGATGGTAAACTCAAACCAGATTGTTTCTCCTCAAAAAGAATCTTAGGATTTCCCCCTG
GTGTGGGAGTTTTCTTAATTATGTTCAATCGATTCCATAATTATGTTGTGGAAATGCTTGCTCA
GTCAGTATTCCCATTTTTATTCTTCTATGTTTGGATATCAAAGCTAACTAGGATTT
CAGAATTAACGACAATGGCCGTTTCACCAAGCCCAAGCCAGAGGCGGAAAAATCTGCTTTTGATAAGTACGACAACGATCTCTTCCAGACAGGTAGACTTGTTACTTGTGGCTTGTATGT
CAATATCGTTTTGAAGGATTATGTCCGTACGATTTTAAATCTCAATCGTACAACTTCGAAATGGGATTTAGATCCGAGAGTTGAGGAGGCAAAGAATCTTTTGAGTAATCCTGCTGCCGA
GGGGGTGGGAAATCAAGTCTCTGCTGAATTTAATTTGA
GTATGTTCCATTCACTTTATGCGTTAAATCTTACCATGCAAATACTTATTTGATAAATAGTTTACCGTTGGCACTCAGCTAT
CTCTCAAAAAGATGAAGAATGGACCAACGCAGAATACACCAGACTCTTCCCTAATAAAAGTCCAGCTGATGTCACGCTTCCCGAACTTCTCAGAGGTCTTTATACGATGGAGGCGGAACT
TCCTACCGATCCTTCTCAACGCTCTTTTGCAAACCTTACCCGTCTTCCCGATGGATCATATGATGAGGGATCTCTCGCATCAATTTTCCAATCATCAGTAGAAGACCTTTCTGGTGCCTT
TGGTGCCGCAAATGTTCCACCTATCATGCGTTCTATCGAAATTCTCTCCATCATACAAAGTCGTTCTTGGAATATGTGCACGCTCAATGAATTCCGTTCTTTCGTGGGATTGACACCTCA
TAAGTCATTTGCCGATATAAATCCAGATCCTATCATTGCAAAACGATTGAAGGAATTTTATGGCAGTCCTGAGGATCTGGAATTGTATCCGCGGGTGGTCGTCAGGAAAACTAAACCCCC
CGTGGTACCCGGTAGTGGTTTGTGTACAGG
GTAATAGTATTAGTTATAGTATCCTTGAGTGATGCCGTTGGGTTGGTTAGAGGGGATAGGTTTTATACTACGGATTATTCGCCGGGGTAC
TCTTACTAACTGGGGGGTTCGTTTATTTACTTTTTCCTCTGTCTTTCTTCTCGACCCTCTCAATCTTAAAAAAGTTACTAACATGGCCAAATAGATATAATGAAGTACAATTCGATACCA
ATATCGATGATGGTGCTGTGCTTTACAAATTAGTCCTTCGAGCTTTCCCGAACTACTTTGAGGGAAATTCTATATATGCTCATTTTCCATTCACAACACCTGAAGTTAACCGTGAGATTC
AAAAGAGCTTGGGAAGAGAGGGGTTGTATAGTTGGGAAGTTCCAAAAAAGAAGGCAGAGCTGTCGAGCGTGCAGACTTGGGATGAATGTAAGGGGATTTTGGAGGATTCGGTTAATTGGA
AG
GTTGGTTTTTCTTTATTCCCAACTATGTGTAGAGGTCACTTTTTGGAGGAAGGCAGTCGGAGAGATACTAACTATGATTAATTTAGGTAACATGGGGTCCACCAATCTCTGTTTTGAC
TTCGCAAGAATCTAGCGACTCTTCAAAAACCGACAGTTCACCCGCTGTTCTACCCTTCTGTCTCGCAGGTGATGCTCCTGTAAATGCTACCTCTCGCTCTCTTATAATATCTTCTTTCTA
TAATCTTCCAACTGGTCATGATCATAAAAATGATAAAGAACATCCGGATTGGTCATCTGCACTCAATCAGTTCTACACGGATAATACGGCCGATTTGTTCGAAAAACATAAAGTTCTCAT
TCCGACTGTTAGCACCTCCGCTTCTACCAATGAAACTAGCACAATCAGCAAAACCTACAGAGTTGACATCGTATCCGACATCTGCAATCGCGTCTTTACTCGTTTTGCAGCTGGTGTTTT
CGATATCCCACTGAAACTCGGAATGGGAAATACAGTCGACGTGAACATAACTACAGACCCCGAAGAAGGATACACAGAAGAAGAATTATATGACTCACTTTCCGTTGCATTCATCTGTAT
CTTCAACAATCTCGACGTTACGAAATCTTTCGCAGTAGATCAACAAGCTCGAGCTATAGCTAAGAAACTTGGAGATATTTTGATGGAGAGGACGAAGGATGGGAAGATTGGTGAAGCTTT
TGATGGGTTGAAGGATAAGTTGCATAGTTTGGTTTTTGATGATAAGACTGAGAGACATGTTGAAGGGTGGGTTCAGAAGGAGAAGGAAAGATTGGCGTTGAAGGGGTATGGGAGGGAAAT
GGTTGAGAGGTTTATAGAGGGGGGGAAGAAG
GTGGGTTGGGGTGTTCAGGAGGTGGTTTGGGAACAAATGTTTGTCCTTTCTTTCTTTTTGTTCCGCCATCCATTTTTTCATTTGTTTTT
CTTTTCTGAATATTTATTTGACTTTTGTGCTTTGGATTCTCGCTAACAAACCCCTCTTGAAATCAGTCTTCCAACTTCAGCAGCAATGACGGCAAATCAATCTCAGCTTCTTTCTCAAGT
TATAGATTATTACCTTA
GTGATGCGGGATCATCACATTTACCACAACTTTATACTCTTGCGCATGGAAATAGCAAGGAGGCTGATAATTTATTGTTACGCTAGTATGTTTTCGCGTTCTC
TTTTCATTCCCGCAAAATAACACAAACCCAAAATAGAAATAAAAATAAAATCTCAAACTAACATCTTAAAGTTTCCTCGAAGCAACCCGAATCCACGGAAACGTCGCCTTACTCCGTCTT
TACTCCCCATCTCAAACCACTTCTCAAACCCCCACATCCACATCCCCATCCAAATCCACCACCTACACCCCAGGAACCGTCTACCTCCTCAACCTCCCCCTCGCTCAACACGACCCTACC
GCCTTCCCGGACCCAGAAACCGTCAAGCTCGATAGAAATCTAAATTCCTACCTCACATTCGGACAGGGAAGACATGAATGTTTGGGAAAAAATGCTGCATTGATGGGTATGTTGAGGGTG
TTTAGGATTATTATTGGTTTGAAGGGTTTGAGACTTGATGTGGGGAAGAATGGAATGGTGAGTGGAGGGATGAAGAGTGTAGGACAAGGATTGGAATTGGG
GTATTTGAGTGAGGAGTGG
GGGAATATAGGTCCGTTTCCGATGAGTTTGAGGGTGCTTTGGGATGAGTGAGGAGGGTAGGGTGGGGTGGGGAGGATATGTTTGAGTGGTGTTTTTTGATGGGTGTTTTTGTTTTTCTTG
CTTTTTTTGTCTGGGTAGTAAGGAGGTAGGATGGGGGTTTTGTTATGATGTTTGTTTCCTTTTTTATTGATACATCAATATACCAACAACTCTCTACTATCTATATTGAATACTAAATAT
TACCTACAACAGGTATACTTCTTTAACTCAACTTATTCCCCTTCAAAAATTCAAATTAAGATATTAATCTAGTCGATTCCACTCTAGTACCAGTACTCTACTCTTTCCTAACATCTCACT
CACTCTCACTCTCACTCTTACTCCTAGTTATTTACTTTCAAAAAGTGCGAAAAAAAGACT
GTATTTTTAAAAATGAATGTATGTATCTAAGTTCTAGGTAACTAGAAACAAAAAATATAT
AAATATATAAATCTTAAAAATATGATTATGTTTTTATAATTATAGGTTTTTATTTTTAGGAATTTGGGATATTAGGATGTTTGAAATGTTTAATTTGATAGGGATGAGAAGAAGAAGAAG
AAGAAGAAAGGTTTTGAAGAAAGTATGAAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATGCTTCAAATAGGAAGAATGGGGAAGTGGATGATAAAGCTTTTGTAAGAAATTTTGGGAAGCGATCGGTAACGGGAAAAAATAACCTGGTAACAAGATACCGAGATTATTTTACT
GGAAAATTCCAAGGGAAATTTAGGAAAAGTGATCGCTTGGATCAGAACTCTTTACCAAAGGAGAATACCAAGTCGAAATCAGAGCCAGTTTCAACATCTCAATTACAATATCAACCACAA
ATCACAACCGAAATCATGTCTGCTGAATCATCCTCAACCCAGCCTGTCTGGACATCTGATACTTCCAAAACAAAACCAACAATCATTTCTGACATCGAATCTGCAACTCATAGCATCCAA
GCCATCTTCCGAGATCTCAAATCCATCACTCCAGAGGATGCAAATACTTTACTCCAACTCTTCTCTTCGGAGATCAAGGGTGTCCAAAATGACAATACGCTTCTTCTAGAAAAGACAGTA
CAATTGCTATCTTCTCAACCAGAAACTTCAGGAATTGGAAAAAGTCTAACAGCAAGTTTTGTGAATACTCTTTGGGATGCTCTACCGCATCCACCTATGAGGAGTTTGGATAAGAAATAT
ATGTATAGGGATGCAGATGGTGGGAATAATAATATTCGGATGCCCGATTTAGGGAGAGCGGGGACGGCTTATGCAAAGAATGTTAATGCTGTGAGAATGAAGAAGAAGGATTTACCTGAT
CCGGGAGAGCTTTTTGATAGTTTGATGAGGAGAGGTGGAATAGATGGAGAAGAGCCGTTTAAAGGGAGTCCGACGGGTATCAGTAGTCAGTTGTTTTATTTGGCTACGATTATTATTCAT
GATCTCTTTCTTACG
GATCATGAAGATATGACTAAGTCCAAGACGAGTAGTTATTTGGATCTCTCACCTCTCTATGGCTGCAATCAAGAAGAGCAAAATGCAATTCGAACATTTGAAGAT
GGTAAACTCAAACCAGATTGTTTCTCCTCAAAAAGAATCTTAGGATTTCCCCCTGGTGTGGGAGTTTTCTTAATTATGTTCAATCGATTCCATAATTATGTTGTGGAAATGCTTGCTCA
A
ATTAACGACAATGGCCGTTTCACCAAGCCCAAGCCAGAGGCGGAAAAATCTGCTTTTGATAAGTACGACAACGATCTCTTCCAGACAGGTAGACTTGTTACTTGTGGCTTGTATGTCAAT
ATCGTTTTGAAGGATTATGTCCGTACGATTTTAAATCTCAATCGTACAACTTCGAAATGGGATTTAGATCCGAGAGTTGAGGAGGCAAAGAATCTTTTGAGTAATCCTGCTGCCGAGGGG
GTGGGAAATCAAGTCTCTGCTGAATTTAATTTGA
TTTACCGTTGGCACTCAGCTATCTCTCAAAAAGATGAAGAATGGACCAACGCAGAATACACCAGACTCTTCCCTAATAAAAGTCCA
GCTGATGTCACGCTTCCCGAACTTCTCAGAGGTCTTTATACGATGGAGGCGGAACTTCCTACCGATCCTTCTCAACGCTCTTTTGCAAACCTTACCCGTCTTCCCGATGGATCATATGAT
GAGGGATCTCTCGCATCAATTTTCCAATCATCAGTAGAAGACCTTTCTGGTGCCTTTGGTGCCGCAAATGTTCCACCTATCATGCGTTCTATCGAAATTCTCTCCATCATACAAAGTCGT
TCTTGGAATATGTGCACGCTCAATGAATTCCGTTCTTTCGTGGGATTGACACCTCATAAGTCATTTGCCGATATAAATCCAGATCCTATCATTGCAAAACGATTGAAGGAATTTTATGGC
AGTCCTGAGGATCTGGAATTGTATCCGCGGGTGGTCGTCAGGAAAACTAAACCCCCCGTGGTACCCGGTAGTGGTTTGTGTACAGG
ATATAATGAAGTACAATTCGATACCAATATCGAT
GATGGTGCTGTGCTTTACAAATTAGTCCTTCGAGCTTTCCCGAACTACTTTGAGGGAAATTCTATATATGCTCATTTTCCATTCACAACACCTGAAGTTAACCGTGAGATTCAAAAGAGC
TTGGGAAGAGAGGGGTTGTATAGTTGGGAAGTTCCAAAAAAGAAGGCAGAGCTGTCGAGCGTGCAGACTTGGGATGAATGTAAGGGGATTTTGGAGGATTCGGTTAATTGGAAG
GTAACA
TGGGGTCCACCAATCTCTGTTTTGACTTCGCAAGAATCTAGCGACTCTTCAAAAACCGACAGTTCACCCGCTGTTCTACCCTTCTGTCTCGCAGGTGATGCTCCTGTAAATGCTACCTCT
CGCTCTCTTATAATATCTTCTTTCTATAATCTTCCAACTGGTCATGATCATAAAAATGATAAAGAACATCCGGATTGGTCATCTGCACTCAATCAGTTCTACACGGATAATACGGCCGAT
TTGTTCGAAAAACATAAAGTTCTCATTCCGACTGTTAGCACCTCCGCTTCTACCAATGAAACTAGCACAATCAGCAAAACCTACAGAGTTGACATCGTATCCGACATCTGCAATCGCGTC
TTTACTCGTTTTGCAGCTGGTGTTTTCGATATCCCACTGAAACTCGGAATGGGAAATACAGTCGACGTGAACATAACTACAGACCCCGAAGAAGGATACACAGAAGAAGAATTATATGAC
TCACTTTCCGTTGCATTCATCTGTATCTTCAACAATCTCGACGTTACGAAATCTTTCGCAGTAGATCAACAAGCTCGAGCTATAGCTAAGAAACTTGGAGATATTTTGATGGAGAGGACG
AAGGATGGGAAGATTGGTGAAGCTTTTGATGGGTTGAAGGATAAGTTGCATAGTTTGGTTTTTGATGATAAGACTGAGAGACATGTTGAAGGGTGGGTTCAGAAGGAGAAGGAAAGATTG
GCGTTGAAGGGGTATGGGAGGGAAATGGTTGAGAGGTTTATAGAGGGGGGGAAGAAG
TCTTCCAACTTCAGCAGCAATGACGGCAAATCAATCTCAGCTTCTTTCTCAAGTTATAGATTA
TTACCTTA
TTTCCTCGAAGCAACCCGAATCCACGGAAACGTCGCCTTACTCCGTCTTTACTCCCCATCTCAAACCACTTCTCAAACCCCCACATCCACATCCCCATCCAAATCCACCACC
TACACCCCAGGAACCGTCTACCTCCTCAACCTCCCCCTCGCTCAACACGACCCTACCGCCTTCCCGGACCCAGAAACCGTCAAGCTCGATAGAAATCTAAATTCCTACCTCACATTCGGA
CAGGGAAGACATGAATGTTTGGGAAAAAATGCTGCATTGATGGGTATGTTGAGGGTGTTTAGGATTATTATTGGTTTGAAGGGTTTGAGACTTGATGTGGGGAAGAATGGAATGGTGAGT
GGAGGGATGAAGAGTGTAGGACAAGGATTGGAATTGGG
TACCAGTACTCTACTCTTTCCTAACATCTCACTCACTCTCACTCTCACTCTTACTCCTAGTTATTTACTTTCAAAAAGTGCG
AAAAAAAGACT
GGATGAGAAGAAGAAGAAGAAGAAGAAAGGTTTTGAAGAAAGTATGAAGTAA

Retrieve as FASTA