Entry information : PtroPGHS02
Entry ID 5940
Creation 2007-10-26 (Christophe Dunand)
Last sequence changes 2010-11-23 (Myriam Duval (Scipio))
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-12-21 (Christophe Dunand)
Peroxidase information: PtroPGHS02
Name PtroPGHS02
Class H synthase    [Orthogroup: PGHS001]
Taxonomy Eukaryota Metazoa Chordata Mammalia Hominidae Pan
Organism Pan troglodytes (chimpanzee)    [TaxId: 9598 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtroPGHS02
start..stop
S start..stop
HsPGHS02 1264 0 137..740 1..604
CfaPGHS02 1165 0 137..740 1..604
OcuPGHS02 1141 0 151..740 15..604
SscPGHS02 1137 0 148..740 12..604
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 166431007..166431276 270 N° 2 166430542..166430731 190 N° 3 166429625..166429741 117 N° 4 166429361..166429504 144
N° 5 166428563..166428706 144 N° 6 166427952..166428133 182 N° 7 166427136..166427219 84 N° 8 166426776..166427022 247
N° 9 166426207..166426493 287 N° 10 166425558..166425705 148 N° 11 166424665..166425074 410  
complement(join(166424665..166425074,166425558..166425705,166426207..166426493,1 66426776..166427022,166427136..166427219,166427952..166428133,166428563..1664287 06,166429361..166429504,166429625..166429741,166430542..166430731,166431007..166 431276))


exon

Literature and cross-references PtroPGHS02
Literature Chimpanzee Sequencing and Analysis Consortium Initial sequence of the chimpanzee genome and comparison with the human genome. Nature 437 (7055), 69-87 (2005).
DNA ref. GenBank:   NC_006468.2 (166431276..166424665)
mRNA ref. GenBank:   XM_524999.2
EST ref. GenBank:   DC525522.1 [5' end]
Protein sequence: PtroPGHS02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   740
PWM (Da):   %s   83509.34  
PI (pH):   %s   8.86
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSAFLNLTRPSLSRRDFLDPLKTYRPDTAAAAGEGIPCAPGPQGGSDSGRGSQVSFCPPPVSHPRRSVQNWLSEALGQRLRGRKDIWRKPRPVVRRLAVSVRSTSRNSSAAPPSAPQPDALRQQSLPPRRALPAAAMLARALLLCAVLALSHTANPCCSHPCQNRGVCMSVGFDQYKCDCTRTGFYGENCSTPEFLTRIKLFLKPTPNTVHYILTHFKGFWNVVNNIPFLRNAIMSYVLTSRSHLIDSPPTYNADYGYKSWEAFSNLSYYTRALPPVPDDCPTPLGVKGKKQLPDSNEIVEKLLLRRKFIPDPQGSNMMFAFFAQHFTHQFFKTDHKRGPAFTNGLGHVDLNHIYGETLARQHKLRLFKDGKMKYQIIDGEMYPPTVKDTQAEMIYPPQVPEHLRFAVGQEFFGLVPGLMMYATIWLREHNRVCDVLKQEHPEWGDEQLFQTSRLILIGETIKIVIEDYVQHLSGYHFKLKFDPELLFNKQFQYQNRIAAEFNTLYHWHPLLPDTFQIHDQKYNYQQFIYNNSILLEHGITQFVESFTRQIAGVAGGRNVPPAVQKVSQASIDQSRQMKYQSFNEYRKRFMLKPYESFEELTGEKEMSAELEALYGDIDAVELYPALLVEKPRPDAIFGETMVEVGAPFSLKGLMGNVICSPAYWKPSTFGGEVGFQIINTASIQSLICNNVKGCPFTSFSVPDPELIKTVTINASSSRSGLDDINPTVLLKERSTEL

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 10 introns) and 1 EST. Isolate="Yerkes chimp pedigree #C0471 (Clint)".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAGCCTTTCTTAACCTTACTCGCCCCAGTCTGTCCCGACGTGACTTCCTCGACCCTCTAAAGACGTACAGACCAGACACAGCGGCGGCGGCGGGAGAGGGGATTCCCTGCGCCCCC
GGACCTCAGGGCGGCTCAGATTCCGGGAGAGGAAGCCAAGTGTCCTTCTGCCCTCCCCCGGTATCCCATCCAAGGCGATCAGTCCAGAACTGGCTCTCGGAAGCGCTCGGGCAAAGACTG
CGAGGAAGAAAAGACATCTGGCGGAAACCT
GTGCGCCTGGGGCGGTGGAACTCGGGGAGGAGAGGGAGGGATCAGACAGGAGAGTGGGGACTACCCGCTCTGCTCCCAAATTGGGGCAGC
TTCCTGGGTTTCCGATTTTCTCATTTGCGTGGGTAAAAAACCCTGCCCCCACCGGGCTTACGCAATTTTTTTAAGGGGAGAGGAGGGAAAAATTTGTGGGGGGTACGAAAAGGCGGAAAG
AAACAGTCATTTCGTCACATGGGCTTGGTTTTCAGTCTTATAAAAAGGAAGGTTCTCTCGGTTAGCGACCAGTTGTCAGACGACTTGCAGTGAGCGTCAGGAGCACGTCCAGGAACTCCT
CAGCAGCGCCTCCTTCAGCTCCACAGCCAGACGCCCTCAGACAGCAAAGCCTACCCCCGCGCCGCGCCCTGCCCGCCGCTGCGATGCTCGCCCGCGCCCTGCTGCTGTGCGCGGTCCTGG
CGCTCAGCCATACAG
GTGAGTACCTGGCGCCGCGCACCGGGGACTCCGGTTCCACGCACCCGGGCAGAGTTTCCGCTCTGACCTCCTGGGTCTATCCCAGTACTCCGACTTCTCTCCGAA
TAGAGAAGCTACGTGACTGGGGAAAGAGCTTGGACCGCTAGAGTCCGAAAGAACTCCGTGGGTATTCCAGCTTTCCCACAAGCACTGATCATTATGAGCCAGTTACTTAACCGATCTGAG
ACACTCTCACCTCCTAAATAGGGATAGATGATACTAATTTGCAGGTTGTCATTATGATAAGACAGGATCTGATCAATATATGTGAATTGTTCATATTTGGAACCTTTTTATTGAGTGGAA
GAAGTTGTTTTAAATACTCTAGTCAGTTCTTTCCTGCTCCCAGGAAAGCCCAGATTATGTTTTAAGATAAGCAAAATGTCTTAAAAGTAAGCTGTTTTACTTTGAATTTTTCCCTAAATG
TTGATTAGTGTACTAGATCCATTTTAATTTGGAAAGTGAAGTGCTACTTATTTGAACTTCTTAAAAATGCTAATTTTAACATCTAAAGAGTTAACTAAGAAAAGCTTAGTAACATGATGT
ACCAAGTTGAATATGCTGTTATCCTCATTTAGAATAGAAAATTGGTATTTCTACGTTTTATCCATTCTAAGGCAGGTTAAAAAATTGTATTTCCATGACTACCTATATATTTCTTGAATT
TATTATTGTAAAGTTGATTCATAGTAAAACAATTAAATGTTTAAATTAAGATTAAGACACTAGAGAATGATTTATTTGCTGTCCTTTAATTGCAGCAAATCCTTGCTGTTCCCACCCATG
TCAAAACCGAGGTGTATGTATGAGTGTGGGATTTGACCAGTATAAGTGCGATTGTACCCGGACAGGATTCTATGGAGAAAACTGCTCAACAC
GTAAGTTTGTCCTTTGGTTGCCTCATTA
GGAGTGGGGCTGGATACAGTTATCATTGTATAGATTTGTGTCTTATAATGAGTCCCATTAATTTCTCCCTCCCTTTCTTCGTCTTCTTGCAGCGGAATTTTTGACAAGAATAAAATTATT
TCTGAAACCCACTCCAAACACAGTGCACTACATACTTACCCACTTCAAGGGATTTTGGAACGTTGTGAATAACATTCCCTTCCTTCGAAATGCAATTATGAGTTATGTGTTGACAT
GTAA
GTACAAGTGTCTTTCTAAGGTTTTTAGCTTTCTCAAAGAAAAATATGCTTTATAATACTGTAAGCCTAATCTAAAAACATATTTCCAAGCTTATCAAAAAGACTTTAAGATACCTTTTAA
GTTTGCCTTCCATCTCAATCGCCAAAAATATTGACATTTAGTCCCATCCAGTTTATACAGTCTGCTCACAACTCTGTATACCTCTTCTAACCTTTACTGTTTGGTCCGTTTGTGGAGGTA
GTATGGTCCAGCTGTTTATTGAATGCCCATGGGCCACAGAATTGTTCTGAACATGTAGCACCCATTAAAATAAATCTGGATTTGGATCAGCAAGAAAATAACTTTCCATGATTCTAAAGT
GGGTGCCATACTCAGCCATTCCTTTCATAGGCCTCTTGGATAGTGAGCAGATGGCTACCTGAAAAATCAATATTGCCAGATTATAATGTGCAGAGTATATGTATTTTATTAAAGATGTAT
TTCAAGTGGCCGTTAGACTATAAAGTGTAGTTGTTTTAAAATAGATTTTTCTTATTTTTGGAGTTAAATTCAACTTCTAGTGCCACTTTCCACATTTTACAATAAAAATAATGGTTGATT
TACTTAACAAATGAGAATAAATAAAACATTTTTTTCTTTGAAAATTTCAGCCAGATCACATTTGATTGACAGTCCACCAACTTACAATGCTGACTATGGCTACAAAAGCTGGGAAGCCTT
CTCTAACCTCTCCTATTATACTAGAGCCCTTCCTCCTGTGCCTGATGACTGCCCGACTCCCTTGGGTGTCAAAG
GTGAGTAAGAAGAATCCATTAGAGATGTATTAACTATAAGACGGGC
TGCATTGCTGCCAAAAAAAAAATTGACCTTAGACTACCATTTATTTATTAACAAAAGCAGTTTTTACTTTTAGCATGGATATCTATGGGTATTTTTTAAAGTATGAGTCTATGTAAACTA
TTATGTAAAAGCAAATGAGCATCTTGGTATAATGTCTTAATATTTTCAAATTATTTCATTAGAAATGAAATAATTCTAATTAAAATAGATAAAATCATTCAGTAAGAAGTTGTTCCACCA
TATCTTAGAACTGTTGTTTATATTATGATCCTATTCACAATTGTAATTCTCATATAAATGAAGAATTCTTGGTATATTGACAGTCACCATCTCCTTTCTTGAATACATAGATGGATTCTT
ATCTTAGCTTTCTCATTTTTCAGGTAAAAAGCAGCTTCCTGATTCAAATGAGATTGTGGAAAAATTACTTCTAAGAAGAAAGTTCATCCCTGATCCCCAGGGCTCAAACATGATGTTTGC
ATTCTTTGCCCAGCACTTCACGCATCAGTTTTTCAAGACAGATCATAAGCGAGGGCCAGCTTTCACCAACGGGCTGGGCCATGGG
GTAAGATAGAGTTAATATCTTAGAGTTAGTAAAAT
TATACCAAATCATAGTCAAGGGCTAACATTAAAGGAGATATACCGATAGATAGACCCAAATAACTTATCCACTTTTTTAAAAAAGAAGCCTTATCTATAAAAACCTTAAAGGAATTTTCC
ATTTACGTCACTGGTCTAGTAAAATTATACACACACACAGACATGCACACACATATATAAACATTCACACACATACATATGTACAGGTATTGTTATTTGTAATTTGACCCCTGTATTTTT
TAGTTTAAAATGTTAGTACTGCAAAATGTTATGTCCTCAAAAACACATTGTATCATGATTATGCTGCTTTCAATATTGTAAAGTGAGGTTTTTGCCGCATTATTATTTTTTGGATTTCAA
TAGCATAGCTTCAAGTTATTCGCAAGAATTTTTTATAAATAATACATTTTTATACTTTTTTAGAATTACCATATCATCATAGTGAAGTATATAATATATATGATATAAGCTCAATATAGT
ATATTAATTCCATTAAACACAAAGACATATCAGTTTGTAGCTTTGGTGGATAAACAAATTAATTTAGCAATTTGTGACTATGAAAAATGTATATTTTATTTAAAAATTTTAAAGAAAGCT
AAATGATCAAATTATTTAATGATGAATTATATGATAGACAATTTATATAAGAAAAACTTCAACAGCAACAAATTAAAATTTTTTCATCATTTTCTAGGTGGACTTAAATCATATTTACGG
TGAAACTCTGGCTAGACAGCATAAACTGCGCCTTTTCAAGGATGGAAAAATGAAATATCAG
GTATCCTTCCTTTGACTATTAAGACTTAGTTATTACCGCTTATACCCATATTTTAAAAT
CCCTAAAAATGTGTTCCTTAACTTTTTAACTGTTTATTATTATTTTTTTTTTAGATAATTGATGGAGAGATGTATCCTCCCACAGTCAAAGATACTCAGGCAGAGATGATCTACCCTCCT
CAAGTCCCTGAGCATCTACGGTTTGCTGTGGGGCAGGAGTTCTTTGGTCTGGTGCCTGGTCTGATGATGTATGCCACAATCTGGCTGCGGGAACACAACAGAGTATGCGATGTGCTTAAA
CAGGAGCATCCTGAATGGGGTGATGAGCAGTTGTTCCAGACAAGCAGGCTAATACTGATAG
GTAAAAAAGAAAATGATTTATATAAAACCCTCTTCCCCAGGGAAAATTAGTGTGCTATC
TTTGTTATGTTTTGAGTAAATGACAAGATATGGTAAATGAAAACTCACACATTCTATATACATTAAATATGTAAGCATGACTGATCATATAGCTATCTTTTGATACTTACAAGGAAGAAA
ACAGAAATGAAGGAATAGCAAATTTTAAAAATTGCATTCCAATTGCTTGAAAGCTTGTGATCAGATGCAATAAATGTTTTTATTATTTATTTTGTGCAAATAGGAGAGACTATTAAGATT
GTGATTGAAGATTATGTGCAACACTTGAGTGGCTATCACTTCAAACTGAAATTTGACCCAGAACTACTTTTCAACAAACAATTCCAGTATCAAAATCGTATTGCTGCTGAATTTAACACC
CTCTATCACTGGCATCCCCTTCTGCCTGACACCTTTCAAATTCATGACCAGAAATACAACTATCAACAGTTTATCTACAACAACTCTATATTACTGGAACATGGAATTACCCAGTTTGTT
GAATCATTCACCAGGCAAATTGCTGGCAGG
GTAAGCATTATTATTGAAAACCAAAACAAAAGACTAGTCAGTAACTTTAGAATTTCTGCCACGGAAATTATTTTTCTTAAACTTACTAAA
AGAGTAGTTAGTTATATTGCTAGTAAAATTATTTTATTGATATAAGAAGCCTAACTTTGTTTGAAAAGTCTAAACTTTTAGTCTAGTCTACAGTTGTCAGACAAATAGCAAATTGTACCC
CTACCTTAAAAATATTTTCAAAAAGTATCTATAATCTTATAGGAATAAATATTTTAGGCTTGAATACTAGTGTTATTTTTGAAATGTAAAAAGGCAAATTAGTTCTAGGCTGGTGTCCCA
TTGAATTTTAAGCAGAGCTCCTGTTGAAATGTAGGTAAGCATCTTTCCAGCAAATAAAAATTGTCTCCGCTGGGAGTTTCAGTTTTACCTGATTTGTACCTAAGGCAAGCTGAATACAAA
CAGTAAATATGCCTAAAATTCTTGTTTTACAACTAATTTTACTTTCCACAGGTTGCTGGTGGTAGGAATGTTCCACCCGCAGTACAGAAAGTATCACAGGCTTCCATTGACCAGAGCAGG
CAGATGAAATACCAGTCTTTTAATGAGTACCGCAAACGCTTTATGCTGAAGCCCTATGAATCATTTGAAGAACTTACAG
GTAAGAAACAGTTTCTAAACTTCTTCGTTTTTTGTTTGTTT
GTTTGTTTTTGTTGTTTTTGGTTTTCTTTTTGAGATGGAGCCGCCCTCTGTCACCCAGGCTGGAGTGCAGTGGCGCCATCTCGGCTCACTGCAACCTCCGCCTCCTGGGTTCAAGCAATT
CTGCCTCAGCTTCCTGAGTAGCTGGGACTACAGGCGCACGTCGCACGCATGGATAATTTTTTGTATTTTCAGTATAGACGGGGTTTCACCGTGTTAGTCAGACTGGTCTCAAACTCCTGA
CCTAGTGATCCGCCGGCTTCGGCCTCCCGAAGTGCTGGGATTACAGGCGTGAGCCACCGCGCCTGGCCCCTAAACTTCTTAAAAGAATCAGGGGTCAAATGGAAACAGAGAAGTTGGCAG
CAAATTGAGCAAAAGAATCAAACTGTTTTTTATTTTGTGAAGTTTGACATTGGTTGTATCTCTGTCTTCATCGCCTTCACAGGAGAAAAGGAAATGTCTGCAGAGTTGGAAGCACTCTAT
GGTGACATCGATGCTGTGGAGCTGTATCCTGCCCTTCTGGTAGAAAAGCCTCGGCCAGATGCCATCTTTGGTGAGACCATGGTAGAAGTTGGAGCACCATTCTCCTTGAAAGGACTTATG
GGTAATGTTATATGTTCTCCTGCCTACTGGAAGCCAAGCACTTTTGGTGGAGAAGTGGGTTTTCAAATCATCAACACTGCCTCAATTCAGTCTCTCATCTGCAATAACGTGAAGGGCTGT
CCCTTTACTTCATTCAGTGTTCCAGATCCAGAGCTCATCAAAACAGTCACCATCAATGCAAGTTCTTCCCGCTCCGGACTAGATGATATCAATCCCACAGTACTACTAAAAGAACGTTCG
ACTGAACTGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAGCCTTTCTTAACCTTACTCGCCCCAGTCTGTCCCGACGTGACTTCCTCGACCCTCTAAAGACGTACAGACCAGACACAGCGGCGGCGGCGGGAGAGGGGATTCCCTGCGCCCCC
GGACCTCAGGGCGGCTCAGATTCCGGGAGAGGAAGCCAAGTGTCCTTCTGCCCTCCCCCGGTATCCCATCCAAGGCGATCAGTCCAGAACTGGCTCTCGGAAGCGCTCGGGCAAAGACTG
CGAGGAAGAAAAGACATCTGGCGGAAACCT
CGACCAGTTGTCAGACGACTTGCAGTGAGCGTCAGGAGCACGTCCAGGAACTCCTCAGCAGCGCCTCCTTCAGCTCCACAGCCAGACGCC
CTCAGACAGCAAAGCCTACCCCCGCGCCGCGCCCTGCCCGCCGCTGCGATGCTCGCCCGCGCCCTGCTGCTGTGCGCGGTCCTGGCGCTCAGCCATACAG
CAAATCCTTGCTGTTCCCAC
CCATGTCAAAACCGAGGTGTATGTATGAGTGTGGGATTTGACCAGTATAAGTGCGATTGTACCCGGACAGGATTCTATGGAGAAAACTGCTCAACAC
CGGAATTTTTGACAAGAATAAAA
TTATTTCTGAAACCCACTCCAAACACAGTGCACTACATACTTACCCACTTCAAGGGATTTTGGAACGTTGTGAATAACATTCCCTTCCTTCGAAATGCAATTATGAGTTATGTGTTGACA
T
CCAGATCACATTTGATTGACAGTCCACCAACTTACAATGCTGACTATGGCTACAAAAGCTGGGAAGCCTTCTCTAACCTCTCCTATTATACTAGAGCCCTTCCTCCTGTGCCTGATGAC
TGCCCGACTCCCTTGGGTGTCAAAG
GTAAAAAGCAGCTTCCTGATTCAAATGAGATTGTGGAAAAATTACTTCTAAGAAGAAAGTTCATCCCTGATCCCCAGGGCTCAAACATGATGTTT
GCATTCTTTGCCCAGCACTTCACGCATCAGTTTTTCAAGACAGATCATAAGCGAGGGCCAGCTTTCACCAACGGGCTGGGCCATGGG
GTGGACTTAAATCATATTTACGGTGAAACTCTG
GCTAGACAGCATAAACTGCGCCTTTTCAAGGATGGAAAAATGAAATATCAG
ATAATTGATGGAGAGATGTATCCTCCCACAGTCAAAGATACTCAGGCAGAGATGATCTACCCTCCTCAA
GTCCCTGAGCATCTACGGTTTGCTGTGGGGCAGGAGTTCTTTGGTCTGGTGCCTGGTCTGATGATGTATGCCACAATCTGGCTGCGGGAACACAACAGAGTATGCGATGTGCTTAAACAG
GAGCATCCTGAATGGGGTGATGAGCAGTTGTTCCAGACAAGCAGGCTAATACTGATAG
GAGAGACTATTAAGATTGTGATTGAAGATTATGTGCAACACTTGAGTGGCTATCACTTCAAA
CTGAAATTTGACCCAGAACTACTTTTCAACAAACAATTCCAGTATCAAAATCGTATTGCTGCTGAATTTAACACCCTCTATCACTGGCATCCCCTTCTGCCTGACACCTTTCAAATTCAT
GACCAGAAATACAACTATCAACAGTTTATCTACAACAACTCTATATTACTGGAACATGGAATTACCCAGTTTGTTGAATCATTCACCAGGCAAATTGCTGGCAGG
GTTGCTGGTGGTAGG
AATGTTCCACCCGCAGTACAGAAAGTATCACAGGCTTCCATTGACCAGAGCAGGCAGATGAAATACCAGTCTTTTAATGAGTACCGCAAACGCTTTATGCTGAAGCCCTATGAATCATTT
GAAGAACTTACAG
GAGAAAAGGAAATGTCTGCAGAGTTGGAAGCACTCTATGGTGACATCGATGCTGTGGAGCTGTATCCTGCCCTTCTGGTAGAAAAGCCTCGGCCAGATGCCATCTTT
GGTGAGACCATGGTAGAAGTTGGAGCACCATTCTCCTTGAAAGGACTTATGGGTAATGTTATATGTTCTCCTGCCTACTGGAAGCCAAGCACTTTTGGTGGAGAAGTGGGTTTTCAAATC
ATCAACACTGCCTCAATTCAGTCTCTCATCTGCAATAACGTGAAGGGCTGTCCCTTTACTTCATTCAGTGTTCCAGATCCAGAGCTCATCAAAACAGTCACCATCAATGCAAGTTCTTCC
CGCTCCGGACTAGATGATATCAATCCCACAGTACTACTAAAAGAACGTTCGACTGAACTGTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAGCCT TTCTTAACCT TACTCGCCCC AGTCTGTCCC GACGTGACTT CCTCGACCCT CTAAAGACGT ACAGACCAGA CACAGCGGCG GCGGCGGGAG AGGGGATTCC CTGCGCCCCC  GGACCTCAGG GCGGCTCAGA TTCCGGGAGA GGAAGCCAAG TGTCCTTCTG CCCTCCCCCG GTATCCCATC CAAGGCGATC AGTCCAGAAC TGGCTCTCGG AAGCGCTCGG GCAAAGACTG  CGAGGAAGAA AAGACATCTG GCGGAAACCT CGACCAGTTG TCAGACGACT TGCAGTGAGC GTCAGGAGCA CGTCCAGGAA CTCCTCAGCA GCGCCTCCTT CAGCTCCACA GCCAGACGCC  CTCAGACAGC AAAGCCTACC CCCGCGCCGC GCCCTGCCCG CCGCTGCGAT GCTCGCCCGC GCCCTGCTGC TGTGCGCGGT CCTGGCGCTC AGCCATACAG CAAATCCTTG CTGTTCCCAC  CCATGTCAAA ACCGAGGTGT ATGTATGAGT GTGGGATTTG ACCAGTATAA GTGCGATTGT ACCCGGACAG GATTCTATGG AGAAAACTGC TCAACACCGG AATTTTTGAC AAGAATAAAA  TTATTTCTGA AACCCACTCC AAACACAGTG CACTACATAC TTACCCACTT CAAGGGATTT TGGAACGTTG TGAATAACAT TCCCTTCCTT CGAAATGCAA TTATGAGTTA TGTGTTGACA  TCCAGATCAC ATTTGATTGA CAGTCCACCA ACTTACAATG CTGACTATGG CTACAAAAGC TGGGAAGCCT TCTCTAACCT CTCCTATTAT ACTAGAGCCC TTCCTCCTGT GCCTGATGAC  TGCCCGACTC CCTTGGGTGT CAAAGGTAAA AAGCAGCTTC CTGATTCAAA TGAGATTGTG GAAAAATTAC TTCTAAGAAG AAAGTTCATC CCTGATCCCC AGGGCTCAAA CATGATGTTT  GCATTCTTTG CCCAGCACTT CACGCATCAG TTTTTCAAGA CAGATCATAA GCGAGGGCCA GCTTTCACCA ACGGGCTGGG CCATGGGGTG GACTTAAATC ATATTTACGG TGAAACTCTG  GCTAGACAGC ATAAACTGCG CCTTTTCAAG GATGGAAAAA TGAAATATCA GATAATTGAT GGAGAGATGT ATCCTCCCAC AGTCAAAGAT ACTCAGGCAG AGATGATCTA CCCTCCTCAA  GTCCCTGAGC ATCTACGGTT TGCTGTGGGG CAGGAGTTCT TTGGTCTGGT GCCTGGTCTG ATGATGTATG CCACAATCTG GCTGCGGGAA CACAACAGAG TATGCGATGT GCTTAAACAG  GAGCATCCTG AATGGGGTGA TGAGCAGTTG TTCCAGACAA GCAGGCTAAT ACTGATAGGA GAGACTATTA AGATTGTGAT TGAAGATTAT GTGCAACACT TGAGTGGCTA TCACTTCAAA  CTGAAATTTG ACCCAGAACT ACTTTTCAAC AAACAATTCC AGTATCAAAA TCGTATTGCT GCTGAATTTA ACACCCTCTA TCACTGGCAT CCCCTTCTGC CTGACACCTT TCAAATTCAT  GACCAGAAAT ACAACTATCA ACAGTTTATC TACAACAACT CTATATTACT GGAACATGGA ATTACCCAGT TTGTTGAATC ATTCACCAGG CAAATTGCTG GCAGGGTTGC TGGTGGTAGG  AATGTTCCAC CCGCAGTACA GAAAGTATCA CAGGCTTCCA TTGACCAGAG CAGGCAGATG AAATACCAGT CTTTTAATGA GTACCGCAAA CGCTTTATGC TGAAGCCCTA TGAATCATTT  GAAGAACTTA CAGGAGAAAA GGAAATGTCT GCAGAGTTGG AAGCACTCTA TGGTGACATC GATGCTGTGG AGCTGTATCC TGCCCTTCTG GTAGAAAAGC CTCGGCCAGA TGCCATCTTT  GGTGAGACCA TGGTAGAAGT TGGAGCACCA TTCTCCTTGA AAGGACTTAT GGGTAATGTT ATATGTTCTC CTGCCTACTG GAAGCCAAGC ACTTTTGGTG GAGAAGTGGG TTTTCAAATC  ATCAACACTG CCTCAATTCA GTCTCTCATC TGCAATAACG TGAAGGGCTG TCCCTTTACT TCATTCAGTG TTCCAGATCC AGAGCTCATC AAAACAGTCA CCATCAATGC AAGTTCTTCC  CGCTCCGGAC TAGATGATAT CAATCCCACA GTACTACTAA AAGAACGTTC GACTGAACTG TAGAAGTCTA ATGATCATAT TTATTTATTT ATATGAACCA TGTCTATTAA TTTAATTATT  TAATAATATT TATATTAAAC TCCTTATGTT ACTTAACATC TTCTGTAACA GAAGTCAGTA CTCCTGTTGC GGAGAAAGGA GTCATACTTG TGAAGACTTT TATGTCACTA CTCTAAAGAT  TTTGCTGTTG CTGTTAAGTT TGGAAAACAG TTTTTATTCT GTTTTATAAA CCAGAGAGAA ATGAGTTTTG ACGTCTTTTT ACTTGAATTT CAACTTATAT TATAAGAACG AAAGTAAAGA  TGTTTGAATA CTTAAACACT GTCACAAGAT GGCAAAATGC TGAAAGTTTT TACACTGTCG ATGTTTCCAA TGCATCTTCC ATGATGCATT AGAAGTAACT AATGTTTGAA ATTTTAAAGT  ACTTTTGGTC ATTTTTCTGT CATCAAACAA AAACAGGTAT CAGTGCACTA CTAAATGAAT ATTTAAATTA GACATTACCA GTAATTTCAT GTCTACTTTT TAAAATCAGC AATGAAACAA  TAATTTGAAA TTTCTAAATT CATAGGGTAG AATCACCTGT AAAAGCTTGT TTGATTTCTT AAAGTTATTA AACTTGTACA TATACCAAAA AGAAGCTGTC TTGGATTTAA ATCTGTAAAA  TCAGTAGAAA TTTTACTACA ATTGCTTGTT AAAATATTTC ATAAGTGATG TTCCTTTTTC ACCAAGAGTA TAAACATTTT TAGTGTGACT GTTAAAACTT CCTTTTAAAT CAAAATGCCA  AATTTATTAA GGTGGTGGAG CCACTGCAGT GTTATCTTAA AATAAGAATA TTTTGTTGAG ATATTCCAGA ATTTGTTTAT ATGGCTTGTA ACATGTAAAA TCTATAGCAG CAAAAGGGTC  TACCTTTAAA ATAAGCAATA ACAAAGAAGA AAACCAAATT ATAGTTCAAA TTTAGGTTTA AACTTTTGAA GCAAACTTTT TTTTATCCTT GTGCACTGCA GGCCTGGTAC TCAGATTTTG  CTATGAGGTT AATGAAGTAC CAAGCTGTGC TTGAATAACG ATATGTTTTC TCAGATTTTC TGTTGTACAG TTTAATTTAG CAGTCCATAT CACATTGCAA AAGTAGCAAT GACCTCATAA  AATACCTCTT CAAAATGCTT AAATTCATTT CACACATTAA TTTTATCTCA AGTCTTGAAG CCAATTCAGT AGGCGCATTG GAATCAAGCC TGGCTACCTG CATGCTGTTC CTTTTCTTTT  CTTCTTTTAG CCATTTTGCT AAGAGACACA GTCTTCTCAT CCCTTCATTT CTCCTATTTT GTTTTACTAG TTTTAAGATC AGAGTTCACT TTCTTTGGAC TCTGCCTATA TTTTCTTACC  TGAACTTTTG CAAGTTTTCA GGTAAACCTC AGCTCAGGAC TGCTATTTAG CTCCTCTTAA GAAGATTAAA AGAGAAAAAA AAGGCCCTTT TAAAAATAGT ATACACTTAT TTTAAGTGAA  AAGCAGAGAG TTTTATTTAT AGCTAATTTT AGCTATCTGT AACCAAGATG GCTGCAAAGA GGCTAGTGCC TCAGAGAGAA CTGTACGGGG TTTGTGACTG GAAAAAGTTA CGTTCCTGTT  CTAATTAATG CCCTTTCTTA TTTAAAAACA AAACCAAACG ATATCTAAGT AGTTCTCAGC AATAATAATA ATGATGATAA TACTTCTTTT CCACATCTCA TTGTCACTGA CATTTAATGG  TACTGTATAT TACTTAATTT ATTGAAGATT ATTATTTATG TCTTATTAGG ACACTATGGT TATAAACTGT GTTTAAGCCT ACAGTCATTG ATTTTTTTTT GTTATGTCAC AATCAGTATA  TTTTCTTTGG GGTTACCTCT CTGAATATTA TGTAAACAAT CCAAAGAAAT GATTGTATTA AGATTTGTGA ATAAATTTTT AGAAATCTGA TTGGTATATT GAGATATTTA AGGTTGAATG  TTTGTCCTTA GGATAGGCCT ATGTGCTAGC CCACAAAGAA TATTGTCTCA TTAGCCTGAA TGTGCCATAA GACTGACCTT TTAAAATGTT TTGAGGGATC TGTGGATGCT TCGTTAATTT  GTTCAGCCAC AATTTATTGA GAAAATATTC TGTGTCAAGC ACTGTGGGTT TTAATATTTT TAAATCAAAC GCTGATTACA GATAATAGTA TTTATATAAA TAATTGAAAA AAATTTCTTT  TAGGAAGAGG GAGAAAATGA AATAAATATC ATTAAAGATA AATAACTCAG GAGAATCTTC TTTACAATTT TATGTTTAGA ATGTTTAAGG TTAAGAAAGA AATAGTCAAT ATGCTTGTAT  AAAACACTGT TCACTGATTT TTTTTTTTAA ACTTGATTTG TTATTAACAT TGATCTGCTG ACAAAACCTG GGAATTTGGG TTGTGTATGT GAATGTTTCA GTGCCTCAGA CAAATGTGTA 
TTTAACTTAT GTAAAAGATA AGTCTGGAAA TAAATGTCTG TTTATTTTTG TACTATTTAA AAATTGACAG ATCTTTTCTG AAGATAAACT TTGATTGTTT CTATA 

Retrieve as FASTA