Entry information : ZmPrx98
Entry ID 5970
Creation 2007-11-13 (Christophe Dunand)
Last sequence changes 2010-12-23 (Marie Brette (Scipio))
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-12-28 (Christophe Dunand)
Peroxidase information: ZmPrx98
Name ZmPrx98
Class Class III peroxidase    [Orthogroup: Prx052]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx98
start..stop
S start..stop
SbPrx129 573 0 1..331 5..332
SbPrx145 557 0 22..331 22..329
SiPrx31 553 0 1..331 1..328
SiPrx30 548 0 1..331 1..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 41760663..41760884 222 N° 2 41760957..41761730 774  
join(41760663..41760884,41760957..41761730)


exon

Literature and cross-references ZmPrx98
DNA ref. GenBank:   AC202927.2 (15131..16195)
Protein sequence: ZmPrx98
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (304)
PWM (Da):   %s   35632.03 (32934.6) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.25 (8.19) Peptide Signal:   %s   cut: 28 range:28-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATRCCAALLLPMALVLFAGSSPPVLAQLELGYYSKTCPNVEAIVRKEMEKIISAAPSLAGPLLRLHFHDCFVRGCDASVLLNSTAGNRLSEMDATPNRSLRGFGSVDRVKAKLEAACPNTVSCADVLTLMARDAVALAKGPVWAVALGRRDGRVSSATEAAGQLPPSYGDVPLLAKIFAAKGLDLKDLAVLSGAHTLGTAHCRSYAGRLYNFSSAYTADPSLDSRYADRLRTRCRSVDDDDAVLSEMDPGSFKTFDTSYYRHVAKRRGLFQSDAALLADATTREYVQRIATGRFDDEFFNDFSESMVKMGNVGVLTGAQGEIRRKCYIVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 9, intron 1). No EST. Also found in AC206948.3
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGACTCGGTGTTGCGCAGCTCTGTTGCTGCCAATGGCCCTCGTGCTCTTCGCAGGTAGCTCACCGCCGGTGCTGGCTCAGCTGGAGCTCGGCTACTACAGCAAGACATGCCCGAAC
GTGGAGGCGATCGTCCGCAAGGAGATGGAGAAGATCATCTCGGCCGCACCCAGCCTCGCTGGCCCGCTCCTCAGGCTTCATTTCCACGACTGCTTCGTCAGG
GTAAGAATTCTTTTCTGA
ATAAATGTTTCCACGACTGCTTCATTGCCTGCCTGTAACGTAAATCGACTGCAGGGCTGTGACGCGTCTGTGCTCCTCAACTCCACCGCGGGTAACCGCCTGTCTGAGATGGACGCCACT
CCGAACAGGAGCCTGCGAGGCTTCGGTTCCGTCGACAGGGTGAAGGCCAAGCTGGAGGCCGCCTGCCCCAACACGGTTTCCTGCGCTGACGTCCTCACGCTCATGGCCCGCGACGCCGTC
GCGCTGGCCAAGGGCCCCGTCTGGGCCGTCGCGCTCGGGAGGCGAGACGGCAGGGTGTCCAGCGCCACGGAGGCGGCCGGCCAGCTGCCCCCGTCCTACGGAGACGTACCGCTGCTGGCC
AAGATTTTCGCGGCGAAAGGCCTCGACCTCAAGGACCTGGCTGTCCTGTCCGGAGCGCACACCCTCGGCACGGCGCACTGCCGGTCTTACGCCGGCCGGCTCTACAACTTCAGCAGCGCC
TACACTGCGGACCCGTCTCTCGACAGCAGGTACGCCGACCGGCTCAGGACGCGCTGCAGGAGCGTCGACGACGACGATGCCGTGCTTTCGGAGATGGACCCCGGCAGCTTCAAGACCTTC
GACACGAGCTACTACCGCCACGTCGCCAAGCGGAGGGGCCTCTTCCAGTCCGACGCCGCGCTCCTCGCCGACGCCACCACTAGGGAGTACGTCCAGCGCATTGCGACCGGCAGGTTTGAC
GACGAGTTCTTCAACGACTTCAGCGAGTCCATGGTCAAGATGGGTAACGTCGGCGTGCTCACCGGTGCACAGGGGGAGATCAGGAGGAAATGCTACATCGTCAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGACTCGGTGTTGCGCAGCTCTGTTGCTGCCAATGGCCCTCGTGCTCTTCGCAGGTAGCTCACCGCCGGTGCTGGCTCAGCTGGAGCTCGGCTACTACAGCAAGACATGCCCGAAC
GTGGAGGCGATCGTCCGCAAGGAGATGGAGAAGATCATCTCGGCCGCACCCAGCCTCGCTGGCCCGCTCCTCAGGCTTCATTTCCACGACTGCTTCGTCAGG
GGCTGTGACGCGTCTGTG
CTCCTCAACTCCACCGCGGGTAACCGCCTGTCTGAGATGGACGCCACTCCGAACAGGAGCCTGCGAGGCTTCGGTTCCGTCGACAGGGTGAAGGCCAAGCTGGAGGCCGCCTGCCCCAAC
ACGGTTTCCTGCGCTGACGTCCTCACGCTCATGGCCCGCGACGCCGTCGCGCTGGCCAAGGGCCCCGTCTGGGCCGTCGCGCTCGGGAGGCGAGACGGCAGGGTGTCCAGCGCCACGGAG
GCGGCCGGCCAGCTGCCCCCGTCCTACGGAGACGTACCGCTGCTGGCCAAGATTTTCGCGGCGAAAGGCCTCGACCTCAAGGACCTGGCTGTCCTGTCCGGAGCGCACACCCTCGGCACG
GCGCACTGCCGGTCTTACGCCGGCCGGCTCTACAACTTCAGCAGCGCCTACACTGCGGACCCGTCTCTCGACAGCAGGTACGCCGACCGGCTCAGGACGCGCTGCAGGAGCGTCGACGAC
GACGATGCCGTGCTTTCGGAGATGGACCCCGGCAGCTTCAAGACCTTCGACACGAGCTACTACCGCCACGTCGCCAAGCGGAGGGGCCTCTTCCAGTCCGACGCCGCGCTCCTCGCCGAC
GCCACCACTAGGGAGTACGTCCAGCGCATTGCGACCGGCAGGTTTGACGACGAGTTCTTCAACGACTTCAGCGAGTCCATGGTCAAGATGGGTAACGTCGGCGTGCTCACCGGTGCACAG
GGGGAGATCAGGAGGAAATGCTACATCGTCAACTAG

Retrieve as FASTA