Entry information : ZmPrx112 (GRMZM2G006727 [6a])
Entry ID 5972
Creation 2007-11-13 (Christophe Dunand)
Last sequence changes 2011-01-21 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-07-01 (Christophe Dunand)
Peroxidase information: ZmPrx112 (GRMZM2G006727 [6a])
Name (synonym) ZmPrx112 (GRMZM2G006727 [6a])
Class Class III peroxidase     [Orthogroup: Prx044]*
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx112
start..stop
S start..stop
BdiPrx81 294 6e-98 3..356 2..341
BdiPrx79 293 3e-97 1..356 1..351
TaPrx99-1B 287 3e-95 1..358 1..337
ZmPrx96 283 1e-93 8..357 6..340
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 85683546..85683761 216 N° 2 85683859..85684824 966  
join(85683546..85683761,85683859..85684824)


exon

Literature and cross-references ZmPrx112 (GRMZM2G006727 [6a])
Protein sequence: ZmPrx112 (GRMZM2G006727 [6a])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   393 (366)
PWM (Da):   %s   41230.91 (38714.6)  
PI (pH):   %s   7.4 (6.87) Peptide Signal:   %s   cut: 28 range:28-393
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKLSAAAVVASLCCCCVLLAGKPAAANDGGFERTVFELVNAAIRGNSTVGGGDPRVGPALIRLLFHDCWNVGCDGSVLLDETPADGTDTEKKAGKSIGLGGFDVIDRIKAELLRSGDDASCADILAFAARDAVGVLSGGRIRYPVRRGRGDGVTSSSAAADAALPSHTPSGGFSELEANFAARGFGKGDLAALCGAHAVGVSHAASFADRLAPSVAAAGQINGTYRLALASRQELLPLTLNYSTATSESMSMSNNVRDTEPAFRAASSYSGVGVDTAARGALDNSYYTANLQNMVLLKSDWELTQDEHTLGRLVQYRDDADRWSEDFGKAMEKLSDLGPPVGARLEIRKKCRLTNPSPRQALVRALKHFLQRRHDQISCLLKLFNAGLVLVL

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 10, intron 1). No EST. Incorrect prediction from Phytozome (very long 3' end with extra exons: 2 ORF).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAAGCTGAGCGCCGCCGCAGTCGTGGCATCCCTCTGCTGCTGCTGCGTGCTGCTCGCCGGGAAGCCAGCGGCGGCCAACGATGGCGGCTTCGAGAGGACCGTGTTCGAGCTAGTG
AACGCCGCCATCAGAGGCAACTCCACCGTCGGCGGCGGCGACCCCCGCGTCGGCCCCGCCCTGATCCGCTTGCTGTTCCACGACTGCTGGGTAAAT
GTACGACATACATACACGTACGCC
ATCCTTCTATAATGTCAGCTTGTGCAGCCAAGAAATGAATGATATAATCGTCTCATCTAATTAATTTGTTTAGGGCTGCGACGGATCCGTGCTGCTGGACGAGACTCCCGCCGACGGGAC
CGACACCGAGAAGAAGGCGGGCAAGAGCATAGGCCTGGGCGGCTTCGACGTGATCGACAGGATCAAGGCAGAGCTCCTCCGGTCCGGCGACGACGCGTCGTGCGCCGACATCTTGGCCTT
CGCGGCACGCGACGCGGTCGGCGTCCTCAGCGGCGGACGGATCAGGTACCCGGTGCGCCGCGGCCGCGGGGACGGCGTGACGTCGTCGTCCGCCGCCGCCGACGCGGCGCTCCCGTCACA
CACGCCGTCCGGCGGCTTCTCCGAGCTGGAGGCCAACTTCGCCGCCAGGGGCTTCGGCAAGGGCGACCTCGCCGCGCTCTGCGGCGCGCACGCGGTCGGCGTCTCACACGCAGCCTCCTT
CGCCGATCGCCTCGCCCCGTCGGTCGCCGCCGCCGGACAGATCAACGGCACGTACCGGCTAGCCCTCGCCTCGCGGCAGGAGCTGCTGCCGCTGACGCTGAATTATTCGACGGCGACGTC
GGAGAGCATGAGCATGAGCAACAACGTCCGCGACACGGAGCCGGCGTTCCGGGCGGCGTCCAGCTACAGCGGCGTCGGGGTGGACACGGCGGCCAGGGGCGCCCTGGACAACAGCTACTA
CACGGCCAACCTGCAGAACATGGTGCTGCTCAAGTCCGACTGGGAGCTCACCCAGGACGAGCACACCCTGGGTCGTCTGGTGCAGTACAGGGACGACGCGGACAGATGGAGCGAGGACTT
CGGCAAGGCCATGGAAAAGCTCAGCGACCTGGGGCCTCCCGTCGGGGCGCGCCTCGAGATCAGGAAGAAGTGCAGGCTCACCAACCCGAGTCCTCGACAAGCACTTGTGCGCGCGCTGAA
GCATTTCTTACAAAGACGCCACGACCAGATATCTTGTTTGCTAAAACTTTTCAATGCAGGGTTGGTGTTAGTCCTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAAGCTGAGCGCCGCCGCAGTCGTGGCATCCCTCTGCTGCTGCTGCGTGCTGCTCGCCGGGAAGCCAGCGGCGGCCAACGATGGCGGCTTCGAGAGGACCGTGTTCGAGCTAGTG
AACGCCGCCATCAGAGGCAACTCCACCGTCGGCGGCGGCGACCCCCGCGTCGGCCCCGCCCTGATCCGCTTGCTGTTCCACGACTGCTGGGTAAAT
GGCTGCGACGGATCCGTGCTGCTG
GACGAGACTCCCGCCGACGGGACCGACACCGAGAAGAAGGCGGGCAAGAGCATAGGCCTGGGCGGCTTCGACGTGATCGACAGGATCAAGGCAGAGCTCCTCCGGTCCGGCGACGACGCG
TCGTGCGCCGACATCTTGGCCTTCGCGGCACGCGACGCGGTCGGCGTCCTCAGCGGCGGACGGATCAGGTACCCGGTGCGCCGCGGCCGCGGGGACGGCGTGACGTCGTCGTCCGCCGCC
GCCGACGCGGCGCTCCCGTCACACACGCCGTCCGGCGGCTTCTCCGAGCTGGAGGCCAACTTCGCCGCCAGGGGCTTCGGCAAGGGCGACCTCGCCGCGCTCTGCGGCGCGCACGCGGTC
GGCGTCTCACACGCAGCCTCCTTCGCCGATCGCCTCGCCCCGTCGGTCGCCGCCGCCGGACAGATCAACGGCACGTACCGGCTAGCCCTCGCCTCGCGGCAGGAGCTGCTGCCGCTGACG
CTGAATTATTCGACGGCGACGTCGGAGAGCATGAGCATGAGCAACAACGTCCGCGACACGGAGCCGGCGTTCCGGGCGGCGTCCAGCTACAGCGGCGTCGGGGTGGACACGGCGGCCAGG
GGCGCCCTGGACAACAGCTACTACACGGCCAACCTGCAGAACATGGTGCTGCTCAAGTCCGACTGGGAGCTCACCCAGGACGAGCACACCCTGGGTCGTCTGGTGCAGTACAGGGACGAC
GCGGACAGATGGAGCGAGGACTTCGGCAAGGCCATGGAAAAGCTCAGCGACCTGGGGCCTCCCGTCGGGGCGCGCCTCGAGATCAGGAAGAAGTGCAGGCTCACCAACCCGAGTCCTCGA
CAAGCACTTGTGCGCGCGCTGAAGCATTTCTTACAAAGACGCCACGACCAGATATCTTGTTTGCTAAAACTTTTCAATGCAGGGTTGGTGTTAGTCCTGTAA

Retrieve as FASTA