Entry information : PtRboh06 (POPTR_0012s11340)
Entry ID 6071
Creation 2008-01-25 (Christophe Dunand)
Last sequence changes 2010-07-15 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtRboh06 (POPTR_0012s11340)
Name (synonym) PtRboh06 (POPTR_0012s11340)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtRboh06
start..stop
S start..stop
PtRboh07 1742 0 1..909 1..909
CclRboh05 1488 0 4..909 1..929
NtRboh04_BelW3 1471 0 11..909 16..938
NbRboh02 1470 0 11..909 16..939
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11819201..11819747 547 N° 2 11818927..11819086 160 N° 3 11818782..11818830 49 N° 4 11818544..11818657 114
N° 5 11818013..11818435 423 N° 6 11817554..11817937 384 N° 7 11817377..11817472 96 N° 8 11817174..11817289 116
N° 9 11816967..11817069 103 N° 10 11816686..11816756 71 N° 11 11815102..11815658 557 N° 12 11814592..11814701 110
complement(join(11814592..11814701,11815102..11815658,11816686..11816756,1181696 7..11817069,11817174..11817289,11817377..11817472,11817554..11817937,11818013..1 1818435,11818544..11818657,11818782..11818830,11818927..11819086,11819201..11819 747))


exon

Literature and cross-references PtRboh06 (POPTR_0012s11340)
Literature REFERENCE 1 JGI, The genome of black cottonwood, Populus trichocarpa (Torr. & Gray). Science 313 (5793), 1596-1604 (2006).
REFERENCE 2 Ralph,S., et al., Genomics of hybrid poplar (Populus trichocarpax deltoides) interacting with forest tent caterpillars (Malacosoma disstria): normalized and full-length cDNA libraries, expressed sequence tags, and a cDNA microarray for the study of insect-induced defences. Mol. Ecol. 15 (5), 1275-1297 (2006).

DNA ref. Phytozome 11:   scaffold_12 (11819747..11814592)
Cluster/Prediction ref. UniGene:   Pth.15866   Pth.13516 [3' end]
Protein sequence: PtRboh06 (POPTR_0012s11340)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   909
PWM (Da):   %s   102784.51 Transmb domain:   %s   o345-364i487-509o529-551i710-727o
PI (pH):   %s   9.4
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQDMGREDHHSDSEMSGSERLAYSGPLSGPLNKRPGRKSARFSIPGTTTSKDEQYVEITLDVRNDSVAVHSVKAANGVEEDPEMALLAKGLEKRSASNVLRTASARIRQVSHEIKRLASFSKRPPPGRLDRSKSAAAHALKGLKFISKTDGGAGWAAVEKRFDEITASTDGLLPRARFCECIGMKESKDFAGELFNALARKRNMHCDSISKAELREFWDQISNQSFDSRLQTFFDMVDKDADGRITEEEVRIITLSASANKLSNIQKQAEEYAALIMEELDPENHGYILIENLEMLLLQGSNQSVRGESRNLSHMLSQKLKPTLDSNPLNRWCRSTKYFLLDNWQRVWVMALWIVFMASLFAYKYIQYRRREAYEVMGHCVCMAKGAAETLKLNMALILLPVCRNTLTWLRNKTKLGVVVPFDDNLNFHKVIAVGIAVGVGIHGISHLACDFPRLLQASEEKWELMQQFFGDQPSSYWHFVKSKEGVTGIVMVVLMAIAFTLATPWFRRNKLNLPTWLKKLTGFNAFWYSHHLFVIVYTLLVVHGYYLYLTHKWYKKTTWMYLAVPVILYGSERLIRALRSSIKAVTIQKVAIYPGNVLALHMSKPQGFRYKSGQYMFVNCAAVSPFEWHPFSITSAPGDDYLSVHIRTLGDWTRQLRTVFSVCQPPPDGKSGLLRSDCFQGHNSNLPRVLIDGPYGAPAQDYKKYEVVLLVGLGIGATPMISIVKDIVSNIRTMEEEENAVENGAGGIGNSPSTKIPSPYTQKRKENFKTRRAYFYWVTREQGSFDWFKGVMNEVAEIDHNHVIELHNYCTSVYEEGDARSALIAMLQSINHAKNGVDIVSGTRVKSHFAKPNWRNVYKRTALNHPDSRGVFYCGAPALTKELRQLALDFSHKTSTKFDFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 2, 11 introns) and 3 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAAGATATGGGTAGAGAAGATCATCACTCTGATTCAGAGATGTCAGGGAGCGAAAGGTTAGCTTACAGCGGTCCATTGAGTGGACCTCTTAATAAAAGACCAGGAAGAAAGAGTGCA
AGGTTTAGCATACCAGGCACGACCACATCCAAAGATGAACAATACGTGGAGATCACCCTTGATGTCCGAAATGATTCTGTGGCTGTACACAGTGTTAAAGCTGCGAATGGTGTTGAGGAG
GATCCTGAGATGGCATTACTTGCCAAAGGTCTAGAGAAAAGATCTGCTTCCAATGTTCTGAGAACTGCTTCAGCAAGAATTAGACAGGTTTCTCATGAAATAAAGCGGTTGGCTTCATTC
TCGAAGAGGCCTCCTCCTGGTCGCCTCGACAGGAGTAAATCTGCCGCGGCTCATGCTTTAAAAGGACTAAAGTTTATCAGCAAGACTGATGGCGGGGCAGGATGGGCTGCTGTGGAGAAG
CGATTCGATGAAATTACTGCTTCTACTGATGGCTTGCTTCCTCGTGCACGATTCTGTGAATGTATAG
GTAATTCTATGTGAATCCACCTCCCTTGTATATATGTTAATGTTTGGACTACA
TGTAATTTCCTGTAGTTAGTCTCGAGTTTTGAAGAATCTGTGTAAATTTGTGCAATGGCAGGAATGAAGGAGTCAAAAGACTTTGCGGGAGAGTTGTTTAATGCACTGGCTAGGAAACGG
AATATGCACTGCGACTCGATCAGTAAAGCTGAGCTGAGGGAATTCTGGGATCAGATTTCCAATCAAAGTTTTGACTCCAGGCTCCAAACTTTCTTTGACAT
GTAAATGATCAGAGATTGT
CTTTCATTTTAATGAAAAGTCCTTCACCTTGTATTGATTTTCAAGCTGAAACTTATGCCAAGTGATGTTAAATGCAGGGTGGATAAAGATGCTGATGGTAGAATCACAGAAGAGGAAGTC
AGAGAG
GTACCATCTTTTGAATGCCTTACAAAACAATTCTTTGGTTTTACCCTTTTGTCTTGAATCAAAGCATGTGCTTTATGTCAGAAAAAGATTTGGACTAAGATAATTTGGAATTTT
ATATATACAGATCATCACCCTTAGTGCTTCTGCAAATAAACTGTCAAATATCCAGAAGCAAGCTGAGGAATATGCAGCATTGATCATGGAAGAATTGGATCCAGAAAATCATGGATACAT
CCTG
GTAATAAACCACAAGTTGAAAATCATTATTAATGTGTTGAGGGTCTGCTATGCATACTGTTGATACTGTCATTAATTATGCATAATTCTTATTCCAAAAAAAAAACAGATAGAGAA
CCTGGAAATGCTTCTATTGCAAGGATCAAACCAGTCTGTAAGAGGAGAAAGCCGAAACCTGAGCCATATGCTAAGCCAGAAGCTTAAGCCTACATTGGATAGCAACCCATTAAACAGATG
GTGTAGAAGCACAAAATATTTCTTATTAGACAACTGGCAAAGAGTTTGGGTAATGGCTCTATGGATTGTTTTCATGGCTAGTTTATTTGCATACAAGTATATACAATATCGACGAAGAGA
GGCGTATGAGGTAATGGGCCATTGTGTATGCATGGCCAAGGGAGCAGCAGAGACGCTCAAACTGAATATGGCTCTAATTTTACTACCTGTCTGCCGAAACACCCTCACCTGGCTCAGGAA
CAAGACCAAACTAGGCGTTGTGGTTCCTTTTGACGACAATCTCAATTTCCACAAG
GTACTATCTAGCATCTACACTTAATGTCTACTACATTGGAAGCAAAAAAAAGCTAATGGTGGTGT
TCATGTTTAGGTGATAGCAGTGGGGATTGCAGTGGGAGTTGGTATCCATGGGATTTCACATTTAGCCTGCGACTTCCCTCGTCTTCTTCAAGCAAGTGAAGAAAAGTGGGAGCTTATGCA
GCAATTTTTCGGGGATCAACCTTCAAGTTACTGGCATTTTGTTAAGTCAAAGGAAGGAGTAACCGGGATCGTAATGGTTGTGTTGATGGCCATAGCCTTCACCCTAGCCACCCCTTGGTT
CAGACGTAATAAGCTCAATTTGCCAACATGGCTCAAGAAACTCACTGGTTTTAATGCATTTTGGTATTCTCACCATCTCTTCGTCATCGTCTACACCCTGCTCGTCGTCCATGGTTATTA
CCTCTACCTGACTCATAAATGGTATAAGAAGACG
GTATGTACCTCTCAGTTATCATGCATTCTTTTTCACTACATTGAAATTAGCCCGCCCTCAAACCTCCAACTCCATTGGCAGACCTG
GATGTACTTGGCAGTTCCTGTGATACTTTACGGCAGTGAAAGATTGATTAGAGCACTGAGATCTAGCATCAAGGCTGTTACCATACAAAAA
GTAATTAATTTTAACCATTTCAACGCAAA
CTTGTGTTTCTAAAAGAATCTTAGAAGCTGTGCTAATGTTCTTCTGGTGGTTCCGAAGGTGGCAATTTACCCTGGAAATGTCTTGGCACTGCACATGTCAAAGCCTCAAGGATTTAGATA
CAAGAGTGGGCAATACATGTTTGTCAACTGTGCTGCTGTCTCTCCATTTGAATG
GTTGGTGACTTCAAAATATTGCCACTCCATATTCTGTCCATTTGTAAACACTTCAAAGAATGTTGT
TGTCATTGCTTTACTTATGGGAAATCACATGTCTACAGGCACCCATTTTCTATTACTTCAGCCCCTGGAGATGACTACCTCAGTGTTCACATTAGAACTCTCGGTGATTGGACAAGGCAG
CTTCGAACAGTGTTCTCAGAG
GTTTGTTTTCTGAGAGTGCATCTGTCATTCTTCTAGATAACAAAGCTATACTACATAGTATCTTGTTCATTCCAAGATTCTAAAAGATACTGCAAAAAA
GTAGATGCAAATTAATCTTCTCACTGACTTTTTTTTAACCATATGTTTCCACTGAACTTTCAGTGCCGCTAATTGTGGCTAATTGCCTGATGCATTTCTTAATTTTGTCAGGTATGTCAG
CCACCTCCTGATGGGAAGAGTGGACTTCTCAGATCTGATTGCTTCCAAGGACACAACTCAAA
GTAAGCTTTAATTTTTAACCGAAGAAATAATATTTTCTACTCACGTATAAATACTGGG
AAAAGAAAAATATTAACGCAGGTTCATGAATGATAATATTATAACCATTTCAAGAAAGGAATCCCTGTAGAGGGCTAGGAGATCTTGGTATGCATATATACTTGACAAGCATTACATTAG
GTCAAACATCTCATTCCAGAGCGAATATTAGGTGGTGGGATACGACAACCTCAGTGCCGTTTACCTACCCTAGTAGAGCAAGTGCTTGCATCACTTTCTGTGTGTCTTGGCTACTTGCTG
GTATGGCCTTTAGTCTCATCCAAGCACTCTATCACGGGCTGCTAGATGATCTACCTTACTTTCATAAATATAGAGCAATGGAGTACAGTTGTAGTCTACTGTTTGTAGCATAACTTGCAA
AAGGCATCAGTGGAAGGAAAACAACCAGTAAATGAGAGGACCACCAGACCAATCATGGTTGGTTTTACTTGGAATATGTTTTCCTTTAGCTTTTCTATTATTTGTACCTCCAATCCTGCT
TCGGATTGAAAGCATGGGATGCTGTCCATTTCAGAGTTATCTCTTGCATCATTTGTCTTTACCACACCAGAATACAAGATAATATAATTAGCAATATCATTGACAAAAGAGAGAGCAAGT
TTACTGGGTTATTCAACAAATTCAAGTCTGAAAAATACTTGTCCATGCACTTAATTAGCCCAGCCACGAACAGCCAACTGTGTTTTCAAAGATTCTGCGCGTCCAAAATCCAAGTGACTA
AACATTATTATTATACGCTGAGTGGATAATTACAGATGAGATGAATCTTGTCATCAAGGACAGCTTGTCACATCATTGAAAAAGACATGTGATTAATGTCCACCCACAAGATGTGGATGT
GCAAGCATGGACTGCAAATTTTACTTTATCGTGTGGCTATTCTCTAGCAAAAATGATGTCTGCCTTGAAAAAAATGTTTCTCCTTTAGGTTGTGCATAGTGATGTATTGATTTTTTATCC
CATGAACAGTTTGCCAAGAGTCTTGATTGACGGTCCATATGGAGCACCAGCACAGGACTACAAGAAATATGAGGTGGTATTGCTTGTTGGTCTAGGAATTGGAGCAACCCCAATGATCAG
CATTGTGAAGGACATAGTGAGTAACATTAGGACGATGGAGGAAGAAGAAAATGCAGTAGAAAATGGTGCTGGTGGAATAGGCAATAGCCCATCAACTAAAATCCCAAGTCCTTATACACA
AAAAAGAAAAGAAAACTTCAAGACGAGGCGAGCATACTTCTATTGGGTGACAAGAGAGCAAGGGTCCTTTGACTGGTTTAAAGGGGTGATGAATGAAGTGGCTGAAATAGACCATAACCA
TGTTATAGAGCTTCACAACTATTGTACCAGTGTTTATGAAGAGGGTGACGCAAGGTCTGCTCTGATTGCCATGCTTCAATCCATAAATCATGCCAAGAATGGTGTGGACATCGTCTCTGG
CACGCGAGTCAAGTCTCACTTCGCCAAGCCTAATTGGCGTAATGTCTACAAGCGCACAGCGCTTAACCACCCTGATTCTAGAGTTG
GTAAGAGCACCTCTCCTATCCTATAGTTTATTGT
GTGTTGTTTTTGCCAAGATCTAGCTCTAAATCTTCCATATTCCTTGAACTAGTTCAGAGTTTTTGCATATTTGAGTCCTTTGCTCTTAATAGGAAAAATCTTCTTTGTGCTTGAAAAGTA
ATCTTTCTTTACACAGTCACTTCCTCAAAAAGAAGATGAAAAAGGTATGTTAATGTGAAAGCAAGTGCTTTTACTGGGTCCAGGTTAGAAAGTTGAGAGATACTGATACCAGAAAAGAAA
GATTGGACAGATTATTGTATTTTCTGAGGATAACAAATCAAATCCTTCCTACAGGATCCATGCCATGCATTGTTCATCTCTTCTAGAAATGAAAATTGAGATATCTGTGTGTATTCACAA
TTGCAGGAGTGTTTTATTGCGGGGCACCAGCATTGACAAAAGAGCTGCGCCAACTAGCCTTGGATTTCTCTCACAAGACCAGTACCAAGTTTGATTTTCACAAAGAAAACTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAAGATATGGGTAGAGAAGATCATCACTCTGATTCAGAGATGTCAGGGAGCGAAAGGTTAGCTTACAGCGGTCCATTGAGTGGACCTCTTAATAAAAGACCAGGAAGAAAGAGTGCA
AGGTTTAGCATACCAGGCACGACCACATCCAAAGATGAACAATACGTGGAGATCACCCTTGATGTCCGAAATGATTCTGTGGCTGTACACAGTGTTAAAGCTGCGAATGGTGTTGAGGAG
GATCCTGAGATGGCATTACTTGCCAAAGGTCTAGAGAAAAGATCTGCTTCCAATGTTCTGAGAACTGCTTCAGCAAGAATTAGACAGGTTTCTCATGAAATAAAGCGGTTGGCTTCATTC
TCGAAGAGGCCTCCTCCTGGTCGCCTCGACAGGAGTAAATCTGCCGCGGCTCATGCTTTAAAAGGACTAAAGTTTATCAGCAAGACTGATGGCGGGGCAGGATGGGCTGCTGTGGAGAAG
CGATTCGATGAAATTACTGCTTCTACTGATGGCTTGCTTCCTCGTGCACGATTCTGTGAATGTATAG
GAATGAAGGAGTCAAAAGACTTTGCGGGAGAGTTGTTTAATGCACTGGCTAGG
AAACGGAATATGCACTGCGACTCGATCAGTAAAGCTGAGCTGAGGGAATTCTGGGATCAGATTTCCAATCAAAGTTTTGACTCCAGGCTCCAAACTTTCTTTGACAT
GGTGGATAAAGAT
GCTGATGGTAGAATCACAGAAGAGGAAGTCAGAGAG
ATCATCACCCTTAGTGCTTCTGCAAATAAACTGTCAAATATCCAGAAGCAAGCTGAGGAATATGCAGCATTGATCATGGAAGAA
TTGGATCCAGAAAATCATGGATACATCCTG
ATAGAGAACCTGGAAATGCTTCTATTGCAAGGATCAAACCAGTCTGTAAGAGGAGAAAGCCGAAACCTGAGCCATATGCTAAGCCAGAAG
CTTAAGCCTACATTGGATAGCAACCCATTAAACAGATGGTGTAGAAGCACAAAATATTTCTTATTAGACAACTGGCAAAGAGTTTGGGTAATGGCTCTATGGATTGTTTTCATGGCTAGT
TTATTTGCATACAAGTATATACAATATCGACGAAGAGAGGCGTATGAGGTAATGGGCCATTGTGTATGCATGGCCAAGGGAGCAGCAGAGACGCTCAAACTGAATATGGCTCTAATTTTA
CTACCTGTCTGCCGAAACACCCTCACCTGGCTCAGGAACAAGACCAAACTAGGCGTTGTGGTTCCTTTTGACGACAATCTCAATTTCCACAAG
GTGATAGCAGTGGGGATTGCAGTGGGA
GTTGGTATCCATGGGATTTCACATTTAGCCTGCGACTTCCCTCGTCTTCTTCAAGCAAGTGAAGAAAAGTGGGAGCTTATGCAGCAATTTTTCGGGGATCAACCTTCAAGTTACTGGCAT
TTTGTTAAGTCAAAGGAAGGAGTAACCGGGATCGTAATGGTTGTGTTGATGGCCATAGCCTTCACCCTAGCCACCCCTTGGTTCAGACGTAATAAGCTCAATTTGCCAACATGGCTCAAG
AAACTCACTGGTTTTAATGCATTTTGGTATTCTCACCATCTCTTCGTCATCGTCTACACCCTGCTCGTCGTCCATGGTTATTACCTCTACCTGACTCATAAATGGTATAAGAAGACG
ACC
TGGATGTACTTGGCAGTTCCTGTGATACTTTACGGCAGTGAAAGATTGATTAGAGCACTGAGATCTAGCATCAAGGCTGTTACCATACAAAAA
GTGGCAATTTACCCTGGAAATGTCTTG
GCACTGCACATGTCAAAGCCTCAAGGATTTAGATACAAGAGTGGGCAATACATGTTTGTCAACTGTGCTGCTGTCTCTCCATTTGAATG
GCACCCATTTTCTATTACTTCAGCCCCTGGA
GATGACTACCTCAGTGTTCACATTAGAACTCTCGGTGATTGGACAAGGCAGCTTCGAACAGTGTTCTCAGAG
GTATGTCAGCCACCTCCTGATGGGAAGAGTGGACTTCTCAGATCTGAT
TGCTTCCAAGGACACAACTCAAA
TTTGCCAAGAGTCTTGATTGACGGTCCATATGGAGCACCAGCACAGGACTACAAGAAATATGAGGTGGTATTGCTTGTTGGTCTAGGAATTGGAGCA
ACCCCAATGATCAGCATTGTGAAGGACATAGTGAGTAACATTAGGACGATGGAGGAAGAAGAAAATGCAGTAGAAAATGGTGCTGGTGGAATAGGCAATAGCCCATCAACTAAAATCCCA
AGTCCTTATACACAAAAAAGAAAAGAAAACTTCAAGACGAGGCGAGCATACTTCTATTGGGTGACAAGAGAGCAAGGGTCCTTTGACTGGTTTAAAGGGGTGATGAATGAAGTGGCTGAA
ATAGACCATAACCATGTTATAGAGCTTCACAACTATTGTACCAGTGTTTATGAAGAGGGTGACGCAAGGTCTGCTCTGATTGCCATGCTTCAATCCATAAATCATGCCAAGAATGGTGTG
GACATCGTCTCTGGCACGCGAGTCAAGTCTCACTTCGCCAAGCCTAATTGGCGTAATGTCTACAAGCGCACAGCGCTTAACCACCCTGATTCTAGAGTTG
GAGTGTTTTATTGCGGGGCA
CCAGCATTGACAAAAGAGCTGCGCCAACTAGCCTTGGATTTCTCTCACAAGACCAGTACCAAGTTTGATTTTCACAAAGAAAACTTCTAA

Retrieve as FASTA