Entry information : PtRboh07 (POPTR_0015s12130 / Potri.015G109800)
Entry ID 6072
Creation 2008-01-25 (Christophe Dunand)
Last sequence changes 2010-07-15 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtRboh07 (POPTR_0015s12130 / Potri.015G109800)
Name (synonym) PtRboh07 (POPTR_0015s12130 / Potri.015G109800)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtRboh07
start..stop
S start..stop
PtRboh06 1770 0 1..909 1..909
NtRboh04_BelW3 1472 0 11..909 16..938
CclRboh05 1470 0 2..909 4..929
NbRboh02 1468 0 11..909 16..939
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 12528407..12528953 547 N° 2 12528121..12528280 160 N° 3 12527959..12528007 49 N° 4 12527697..12527810 114
N° 5 12527129..12527551 423 N° 6 12526654..12527037 384 N° 7 12526471..12526566 96 N° 8 12526265..12526380 116
N° 9 12526086..12526188 103 N° 10 12525892..12525962 71 N° 11 12524399..12524955 557 N° 12 12523744..12523853 110
complement(join(12523744..12523853,12524399..12524955,12525892..12525962,1252608 6..12526188,12526265..12526380,12526471..12526566,12526654..12527037,12527129..1 2527551,12527697..12527810,12527959..12528007,12528121..12528280,12528407..12528 953))


exon

Literature and cross-references PtRboh07 (POPTR_0015s12130 / Potri.015G109800)
Literature REFERENCE 1 JGI, The genome of black cottonwood, Populus trichocarpa (Torr. & Gray). Science 313 (5793), 1596-1604 (2006).
DNA ref. Phytozome 11:   scaffold_15 (12528953..12523744)
Omic ref. ePlant:   Potri.015G109800
Protein sequence: PtRboh07 (POPTR_0015s12130 / Potri.015G109800)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   0
PWM (Da):   %s   Transmb domain:   %s   o345-367i487-509o529-551i710-727o
PI (pH):   %s   6.11
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQDTGREDHHSDTELSGSERVAYSGPLSGPLNKRPGKKSARFNIPETTTSKDEQYVEITLDVRNDFVAVHSVKPSHGVKEDPEMTLLAKGPDKRSVSNVVRTASARIRQVSHEIKRLASFSKRPPPGRLDRSKSAAAHALKGLKFISKTDGGAGWAAVEKRFDEITASTEGLLPRARFCECIGMKESKEFAGELFSSLARKRNIQCDSINKAELREFWEQISNQSFDSRLQTFFDMVDKDADGRITEEEVRIITLSASANKLSNIQKQAEEYAALIMEELDPENHGYIMIENLEMLLLQGPSQSAGGESRNLSRMLSQKLKPTLDSNPLNRWGRGTRYFLLDNWQRVWVMALWIAVMASLFAYKYVQYRRRAAYVVMGHCVCMAKGAAETLKLNMALILLPVCRNTLTWLRNKTKLGVAVPFDDNLNFHKVIAVGVAVGVGIHGISHLACDFPRLLRASEEKWELMQQFFGDQPSSYWHFVKSKEGVTGILMVVLMAIAFTLATPWFRRNKLNLPTWLKKLTGFNAFWYSHHLFVIVYTLLIVHGYYLYLTHEWYKKTTWMYLTVPVMLYGGERFIRALRSSIKAVTIQKVAIYPGNVLALHMSKPQGFRYKSGQYMFVNCSAVSPFEWHPFSITSAPGDDYLSVHIRTLGDWTLQLRTVFSACQPPPNGKSGLLRADCFQGHSPNFPRVLIDGPYGAPAQDYKKYEVLLLVGLGIGATPMISIVKDIASNIRAMEEEEKALENGTDGAGNSPLTRTPSPNAHKRKESFKTRRAYFYWVTREQGSFDWFKGVMNEVAELDHNHVIELHNYCTSVYEEGDARSALIAMLQSINHAKNGVDIVSGTRVKSHFAKPDWRNVYKRTALNHPDSRGVFYCGAPALTKELRQLALDFSHKTSTKFDFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 15, 11 introns). No EST, only from other populus species. Incorrect prediction from Phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAAGATACGGGTAGAGAAGATCATCACTCTGACACAGAGCTATCGGGGAGCGAAAGGGTAGCTTACAGTGGTCCATTGAGCGGACCTCTGAATAAAAGACCTGGAAAAAAGAGTGCG
AGGTTTAATATACCAGAAACAACCACATCCAAGGATGAACAATACGTGGAGATCACTCTTGATGTCCGAAATGATTTTGTGGCTGTACACAGCGTTAAACCTTCTCATGGCGTCAAAGAA
GATCCTGAGATGACATTACTTGCTAAAGGTCCAGATAAAAGATCTGTTTCCAATGTTGTGAGAACTGCTTCAGCAAGAATTAGACAGGTTTCTCATGAAATAAAACGGTTGGCTTCGTTC
TCAAAGAGGCCTCCTCCTGGTCGCCTTGACAGGTCTAAATCTGCAGCTGCTCATGCTTTAAAAGGACTAAAGTTTATCAGCAAGACTGATGGTGGTGCAGGATGGGCTGCTGTGGAAAAG
CGTTTCGATGAAATTACTGCTTCTACTGAGGGCTTGCTTCCTCGTGCGCGATTCTGTGAATGTATAG
GTAATTCAATGCAAATTTCCTTCCTTCTAACTTGTAGATATGTGAATGTGTTT
GGTTTGGACTGAATGTTATTTGCTTTAGTTAGTTTGAGTTTTGAAGGGCCTGTGTAAATTCATGTAATGGCAGGAATGAAGGAGTCAAAGGAGTTTGCAGGAGAGCTGTTCAGTTCACTT
GCAAGGAAGCGGAATATACAATGTGATTCGATCAACAAAGCTGAGCTGAGGGAATTCTGGGAACAGATTTCCAACCAAAGTTTCGACTCCAGGCTCCAAACTTTCTTTGACAT
GTAAATG
AATCTCTCTCTTTCACTCAAAGATTATGTCTTTCATTTTAATTAAAAAGTCCTCCACCTTATATTGATTTCAAGCTGGAACTTATACCAAGTGATGTAAAATGCAGGGTGGATAAAGATG
CTGATGGCAGAATCACAGAAGAGGAAGTCAGAGAG
GTGCTACCGTCTTTTGAATGCCTTACTGAACATTTCTTTTTAGCTTTACCCTTTTTGTCTTGAATGAAACACTTGACTTGAATCA
AAGCTTGTGCCTTGTGTCAGAAAAGGATTTGGCCTAAGAAAATTTGGCAATTTTTATATGCAGATCATTACCCTTAGCGCTTCTGCAAATAAACTGTCAAATATCCAGAAACAAGCTGAG
GAATATGCAGCATTAATCATGGAAGAGTTAGATCCAGAAAATCATGGATACATCATG
GTAATAAACCACAAGTTTAAAGCATTATTAATGTCTTGAGGGTCTGCTTGTTTGGAGTTTTTT
TTTTATGCAGATTGCTGATACTCTTATTAATGATGCATGGTTCCCTGTTTTTTTTTTTTTAAAAAAAAAAAAAAAACAACAGATAGAGAACCTGGAAATGCTTCTATTGCAAGGACCAAG
CCAGTCGGCAGGAGGAGAAAGCCGAAATCTGAGCCGTATGCTAAGCCAGAAGCTTAAGCCTACATTGGATAGCAACCCATTAAACAGATGGGGCAGAGGCACCAGGTATTTCTTATTAGA
CAACTGGCAGAGAGTTTGGGTAATGGCTCTATGGATTGCTGTTATGGCTAGCCTATTTGCATACAAGTATGTGCAGTATCGACGCAGAGCGGCGTATGTGGTGATGGGTCATTGTGTATG
CATGGCCAAGGGTGCAGCTGAGACACTCAAACTGAATATGGCTCTAATTCTACTACCTGTCTGCCGAAACACTCTCACCTGGCTCAGGAACAAAACCAAATTAGGTGTCGCGGTTCCTTT
TGACGACAACCTCAATTTCCACAAG
GTTCTATCTAGCATCTACGTACCCTCTAGTATCTACGCTTAATGTCTTCTAAACTGGAAGCACGGAAACTAATGGTGGTGTCCTTGTTCAGGTTA
TAGCAGTTGGAGTTGCAGTTGGAGTTGGTATCCATGGGATTTCTCATCTAGCGTGTGACTTCCCTCGCCTTCTTCGTGCAAGTGAAGAAAAGTGGGAGCTCATGCAGCAATTTTTCGGGG
ATCAACCTTCAAGTTACTGGCATTTTGTCAAGTCCAAGGAAGGAGTAACTGGGATCCTCATGGTAGTGTTGATGGCTATAGCCTTCACACTAGCCACCCCTTGGTTCAGACGTAATAAGC
TCAATTTGCCGACATGGCTCAAGAAGCTCACCGGTTTCAATGCATTTTGGTATTCTCACCATCTCTTCGTCATCGTCTACACCCTGCTCATCGTGCACGGTTATTACCTCTACCTGACTC
ATGAATGGTACAAGAAGACG
GTAAGTGCCTCTCAGTTATCATATATTCTTTTATTTCACTGCATTGATTGAAATCTCAGTCCATCCTTGAACCTCCACCATTGGCAGACCTGGATGTACT
TGACAGTTCCTGTTATGCTTTACGGGGGTGAAAGATTCATTAGGGCACTGAGATCAAGCATCAAGGCTGTTACCATACAAAAA
GTAACTATTTTTAACCATTTTTACATCGACTTAATTA
CTTTTCAGAAATGATTTTAGAAGTTGTGCTAATTTCTTCTGGTTGTTTTGAAGGTGGCAATTTATCCTGGAAATGTCCTGGCACTTCACATGTCAAAGCCTCAAGGATTTAGATACAAGA
GTGGGCAATACATGTTTGTCAATTGTTCTGCTGTCTCTCCATTCGAATG
GTAGTTAAACTTCAAAATATTCCTACCCCTTGTGATATCCATTTGTAAATACTCATGGTAAATCACATGTC
AACAGGCACCCATTTTCTATTACTTCAGCCCCTGGAGATGACTACCTTAGTGTTCATATCAGAACTCTTGGTGATTGGACACTGCAGCTTCGAACAGTGTTCTCAGAGGTGTGTTTTCTT
ACAAGTGCATTTGTTATTCTTCTAGAAGAAAAAAAGAAGTCTTACTATATTATGTCCTGTTCATTTCCAAGATTGTATATGTGCAACAAAGTAAGTGTTTTTTTTTCTCAGGCATGCCAA
CCACCTCCTAATGGGAAGAGTGGACTTCTCAGAGCTGACTGCTTCCAAGGACACAGCCCAAA
GTGAGCATTAATTTTTATGATATTTTCTATTCACGTATAATTACTAGCTAAAATAAAA
TAAAAATCCCTTCTGATGAATGATAATATCATAACCATTTCAAAAAGAAAGGAAAGCATATAGAGGGTTTGTGGATCATGGTATGCATAAACGTGACAAGCATTACATGAGGTCAAACAT
CTCAGTCCAGAGCGAATCTCAAGTGGTTGGATACCACAACCTTATTGCCGATGTACCTACCCTAGGCGAGCAGGTGCTTTCTTCACTTTGTGTGTATCTTAGCTATTTGCTGTTAGGGTC
TTTCCTCTCATACAAGTAATCTATCAAGGGCTACTAGATAAGATCTACCTTATTTTCGTAAACATAAGAGCTATGGAGTACAGCCATGTGTATTAGTCCACTGTTATGAACAAATGAGAA
GCACCAAACCAATCAGTGTTTACTTCACTGGGAATATGAATTATAGAATGCTGTCTTTTTCAGAGTGGTATCTTTGCATCATTTGTCGTTACCGCACTATAATAAAGGAAGGCGGGATTA
GCAATATCATTGATAGGAAGAGAAAAAGTTTGCTAGGTTACTTGACAAACTTCAAGTTTAGAAAACATTTGTGCATGCGCTTAATTAGTATAGTTAAATAATGCCAACTGTGTTTTAAAA
TATTTTGCACATCCAATAATCCAAGTTTTAGACATTATTAGACACGGAAAGGATAGAGATTAATTTGTCATCATGGACAGCCTGCCCCATCGTTGAAAACGACATGTAACAAACATGTAA
ACAATGCCACCCACGAGATGTAGATGCGCATCAATGAGCTGCAAGTAGTCCTTTTTCACATGGATATTCCCTAGCATAGAAAGATGTCTGCCTAGAAAAAAAGTGTTTCCTGTTTAGGTT
GTGCATAATGATGTGATGATTTTTTATCCTATGAGCAGTTTCCCAAGAGTCTTGATTGACGGTCCATATGGAGCACCAGCACAAGACTACAAGAAATATGAGGTGTTATTGCTCGTTGGC
CTAGGAATTGGAGCAACCCCAATGATCAGCATTGTCAAGGACATAGCGAGTAACATCAGGGCCATGGAGGAAGAAGAGAAAGCATTAGAAAATGGTACTGATGGGGCAGGCAATAGCCCG
TTAACTAGAACTCCAAGCCCTAATGCACACAAAAGAAAAGAAAGCTTCAAGACAAGGAGAGCATACTTCTATTGGGTGACAAGAGAACAAGGTTCCTTTGACTGGTTTAAAGGGGTTATG
AATGAAGTGGCTGAATTAGACCATAACCATGTCATAGAGCTTCACAACTACTGTACTAGTGTTTATGAAGAGGGTGATGCAAGGTCTGCTCTAATTGCCATGCTTCAATCCATTAATCAT
GCCAAGAATGGTGTGGACATTGTCTCTGGCACACGAGTCAAGTCTCACTTCGCCAAGCCTGATTGGCGTAATGTCTACAAGCGCACTGCGCTTAACCACCCTGATTCTCGGGTTG
GTAAG
TGAACTTCTCCAATCCTATAGTTTATTACGTGTTATATGCACTAGAATCTGATACTGCAAGCTTCCATATTCTTTTGAACTGGTTCATTCCTTTTGCATAATTAAGCCCTCAGCTCTTAA
AAAGAAACTCTTCTTTATGCTTAAAAAGATGTCTTTGTTTACTATGTTTGTCACTTTCTCAAAAAGAAAATATATTGAAGTGAGTGCTAGTGCTTTTGCAAAGGATGAAGATAATTACAT
TACTAGTGCTTTTGTAAAGGATGATGATAGTTACATTAAGTGTTTATCTCCTATTAAATCAACATTAGCATGATCCATTAAAGTTCCTTATGACCCTTGCTCTCTAGCAGAGTAAAAAGA
TATTTTACCGGGTCCATGTAAGAAAGTTGAAAGATACTGATACCAGAAAGGAAGGATTGGGTATTTTACTATATTTGCTGAGGATAACAAATCAAATCTTTCGTACAGTGTTTATGCCAT
GCATTATTTATCACTTTTAGAAATGAAAGTTGAGATACCTGTAACTATTCACAATTGCAGGAGTGTTTTATTGTGGGGCACCAGCATTGACAAAAGAGCTGCGCCAGCTAGCCTTGGATT
TCTCTCACAAGACCAGCACTAAGTTTGATTTTCACAAAGAAAACTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAAGATACGGGTAGAGAAGATCATCACTCTGACACAGAGCTATCGGGGAGCGAAAGGGTAGCTTACAGTGGTCCATTGAGCGGACCTCTGAATAAAAGACCTGGAAAAAAGAGTGCG
AGGTTTAATATACCAGAAACAACCACATCCAAGGATGAACAATACGTGGAGATCACTCTTGATGTCCGAAATGATTTTGTGGCTGTACACAGCGTTAAACCTTCTCATGGCGTCAAAGAA
GATCCTGAGATGACATTACTTGCTAAAGGTCCAGATAAAAGATCTGTTTCCAATGTTGTGAGAACTGCTTCAGCAAGAATTAGACAGGTTTCTCATGAAATAAAACGGTTGGCTTCGTTC
TCAAAGAGGCCTCCTCCTGGTCGCCTTGACAGGTCTAAATCTGCAGCTGCTCATGCTTTAAAAGGACTAAAGTTTATCAGCAAGACTGATGGTGGTGCAGGATGGGCTGCTGTGGAAAAG
CGTTTCGATGAAATTACTGCTTCTACTGAGGGCTTGCTTCCTCGTGCGCGATTCTGTGAATGTATAG
GAATGAAGGAGTCAAAGGAGTTTGCAGGAGAGCTGTTCAGTTCACTTGCAAGG
AAGCGGAATATACAATGTGATTCGATCAACAAAGCTGAGCTGAGGGAATTCTGGGAACAGATTTCCAACCAAAGTTTCGACTCCAGGCTCCAAACTTTCTTTGACAT
GGTGGATAAAGAT
GCTGATGGCAGAATCACAGAAGAGGAAGTCAGAGAG
ATCATTACCCTTAGCGCTTCTGCAAATAAACTGTCAAATATCCAGAAACAAGCTGAGGAATATGCAGCATTAATCATGGAAGAG
TTAGATCCAGAAAATCATGGATACATCATG
ATAGAGAACCTGGAAATGCTTCTATTGCAAGGACCAAGCCAGTCGGCAGGAGGAGAAAGCCGAAATCTGAGCCGTATGCTAAGCCAGAAG
CTTAAGCCTACATTGGATAGCAACCCATTAAACAGATGGGGCAGAGGCACCAGGTATTTCTTATTAGACAACTGGCAGAGAGTTTGGGTAATGGCTCTATGGATTGCTGTTATGGCTAGC
CTATTTGCATACAAGTATGTGCAGTATCGACGCAGAGCGGCGTATGTGGTGATGGGTCATTGTGTATGCATGGCCAAGGGTGCAGCTGAGACACTCAAACTGAATATGGCTCTAATTCTA
CTACCTGTCTGCCGAAACACTCTCACCTGGCTCAGGAACAAAACCAAATTAGGTGTCGCGGTTCCTTTTGACGACAACCTCAATTTCCACAAG
GTTATAGCAGTTGGAGTTGCAGTTGGA
GTTGGTATCCATGGGATTTCTCATCTAGCGTGTGACTTCCCTCGCCTTCTTCGTGCAAGTGAAGAAAAGTGGGAGCTCATGCAGCAATTTTTCGGGGATCAACCTTCAAGTTACTGGCAT
TTTGTCAAGTCCAAGGAAGGAGTAACTGGGATCCTCATGGTAGTGTTGATGGCTATAGCCTTCACACTAGCCACCCCTTGGTTCAGACGTAATAAGCTCAATTTGCCGACATGGCTCAAG
AAGCTCACCGGTTTCAATGCATTTTGGTATTCTCACCATCTCTTCGTCATCGTCTACACCCTGCTCATCGTGCACGGTTATTACCTCTACCTGACTCATGAATGGTACAAGAAGACG
ACC
TGGATGTACTTGACAGTTCCTGTTATGCTTTACGGGGGTGAAAGATTCATTAGGGCACTGAGATCAAGCATCAAGGCTGTTACCATACAAAAA
GTGGCAATTTATCCTGGAAATGTCCTG
GCACTTCACATGTCAAAGCCTCAAGGATTTAGATACAAGAGTGGGCAATACATGTTTGTCAATTGTTCTGCTGTCTCTCCATTCGAATG
GCACCCATTTTCTATTACTTCAGCCCCTGGA
GATGACTACCTTAGTGTTCATATCAGAACTCTTGGTGATTGGACACTGCAGCTTCGAACAGTGTTCTCAGAG
GCATGCCAACCACCTCCTAATGGGAAGAGTGGACTTCTCAGAGCTGAC
TGCTTCCAAGGACACAGCCCAAA
TTTCCCAAGAGTCTTGATTGACGGTCCATATGGAGCACCAGCACAAGACTACAAGAAATATGAGGTGTTATTGCTCGTTGGCCTAGGAATTGGAGCA
ACCCCAATGATCAGCATTGTCAAGGACATAGCGAGTAACATCAGGGCCATGGAGGAAGAAGAGAAAGCATTAGAAAATGGTACTGATGGGGCAGGCAATAGCCCGTTAACTAGAACTCCA
AGCCCTAATGCACACAAAAGAAAAGAAAGCTTCAAGACAAGGAGAGCATACTTCTATTGGGTGACAAGAGAACAAGGTTCCTTTGACTGGTTTAAAGGGGTTATGAATGAAGTGGCTGAA
TTAGACCATAACCATGTCATAGAGCTTCACAACTACTGTACTAGTGTTTATGAAGAGGGTGATGCAAGGTCTGCTCTAATTGCCATGCTTCAATCCATTAATCATGCCAAGAATGGTGTG
GACATTGTCTCTGGCACACGAGTCAAGTCTCACTTCGCCAAGCCTGATTGGCGTAATGTCTACAAGCGCACTGCGCTTAACCACCCTGATTCTCGGGTTG
GAGTGTTTTATTGTGGGGCA
CCAGCATTGACAAAAGAGCTGCGCCAGCTAGCCTTGGATTTCTCTCACAAGACCAGCACTAAGTTTGATTTTCACAAAGAAAACTTCTAA

Retrieve as FASTA