Entry information : PtRboh01 (POPTR_0001s12650)
Entry ID 6073
Creation 2008-01-28 (Christophe Dunand)
Last sequence changes 2010-07-15 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtRboh01 (POPTR_0001s12650)
Name (synonym) PtRboh01 (POPTR_0001s12650)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtRboh01
start..stop
S start..stop
PtRboh04 1693 0 1..926 1..926
CsRboh02 1513 0 2..926 1..912
CclRboh02 1513 0 2..926 1..912
VvRboh03 1456 0 13..926 5..924
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 9800583..9801177 595 N° 2 9801261..9801423 163 N° 3 9801525..9801573 49 N° 4 9801765..9801878 114
N° 5 9802081..9802509 429 N° 6 9802594..9802980 387 N° 7 9803092..9803187 96 N° 8 9803297..9803412 116
N° 9 9803541..9803643 103 N° 10 9803734..9803804 71 N° 11 9803994..9804541 548 N° 12 9804673..9804782 110
join(9800583..9801177,9801261..9801423,9801525..9801573,9801765..9801878,9802081 ..9802509,9802594..9802980,9803092..9803187,9803297..9803412,9803541..9803643,98 03734..9803804,9803994..9804541,9804673..9804782)


exon

Literature and cross-references PtRboh01 (POPTR_0001s12650)
Protein ref. UniProtKB:   B9GMW7
DNA ref. Phytozome 11:   scaffold_1 (9800583..9804782)
Protein sequence: PtRboh01 (POPTR_0001s12650)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   0
PWM (Da):   %s   Transmb domain:   %s   o366-385i507-529o549-571i730-747o
PI (pH):   %s   6.11
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MIRSEGLRGAYSEDSSDTESTASDRTAFSGPLGSGGGGLLNKKHSSKKSAGFNIPPETTINSGFTDDSSSFVEITLDICDDSVAVHSVQGANEDPELTLLAKTALEGNNSSSLRSSLFRNTSSKIRQVSQELKRFASRRSSTARRFDRTKSAAAHALKGLKFITAKTGNGWPAVEKRFQELTASTDGLLPCSLFGECIGMNKDSKEFANELFRALARRHNTNGDSINKAQLRQFWDQIADESFDSRLQTFFDMVDKDADGRITEEEVLIISLSASANKLSNIQKQAKEYAALIMEELDPDNAGYIMIYNLETLLLQASTQSFRVSDSRVLSELLSQKLKPTQENNPLKRWYPKVKYFLMDNWQRVWIMMLWMGIVAGLFTYKFIEYRHNKAAYDVMGYCVCVAKGGAETLKFNMALILLPVCRNTITWLRNKTKLGVAVPFDDNLNFHKVIAVGIAIGTGLHAGAHITCDFPRLLHATEKEYEPLKPYFGDEQPDNYGWFLKGVEGITGIIMVVLMAIAFTLATPWFRRNRLNLPKPLKKLTGFNAFWYSHHLFVIVYTLLVVHGIYLYLTKTWYKKTTWIYLAVPVILYACERLIRAFRSSTRAVKILKVAVYPGNVLALHMSKPQGFKYKSGQYMFVNCAAVSPFQWHPFSITSSPGDDYLSVHIRTLGDWTRQLQTVFSVCQPPPAGKSGLLRADMQGENNPSFPKILIDGPFGAPAQEYKKYDVVLLVGLGIGATPMVSIVKDIINNKKLKDKDGEDNGALEGLESGRGPPNKNKISTSRSFKTRKAYFYWVTREQGSFEWFKEIMNEVAEMDDKQVIEMHNYCTSVYEEGDARSALIAMLQSLNHAKNGVDVVSGTRVKSHFAKPIWRQVYKKIALRHPDARGVFYCGAPALTKELRQLALDFSHKTSTEFDFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 1, 11 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATCAGAAGCGAGGGCTTGAGGGGAGCTTATTCTGAGGACAGTTCGGACACAGAAAGCACAGCAAGTGACAGAACAGCTTTTAGTGGGCCTTTAGGTTCAGGAGGAGGAGGACTTCTC
AATAAAAAGCATTCTTCCAAGAAGAGCGCGGGGTTCAATATTCCTCCTGAAACCACCATAAATTCCGGCTTCACTGACGATTCATCTTCCTTTGTAGAGATTACTTTGGATATTTGTGAC
GATTCTGTGGCGGTTCACAGCGTTCAGGGTGCTAATGAGGATCCCGAATTGACTTTGCTGGCGAAGACAGCGCTAGAGGGAAACAATTCCTCTTCGCTGCGGTCTTCCTTGTTTAGGAAC
ACATCGTCCAAAATCAGGCAGGTCTCTCAGGAGCTAAAACGTTTCGCTTCAAGAAGGTCATCCACAGCTAGACGGTTTGATAGGACTAAGTCAGCTGCTGCTCATGCCTTGAAGGGACTT
AAGTTCATTACTGCTAAAACTGGAAATGGATGGCCTGCTGTTGAGAAGCGATTTCAAGAACTTACTGCCTCTACCGATGGCCTCCTTCCATGTTCCTTGTTTGGCGAATGCATAG
GTGAG
TACCGCTGTTGGCTATTAACTTATTCATCCTCCTTCTGCGATTGTTTGCTTACTGATCACTATATTTGTATATGACAGGTATGAACAAGGACTCTAAGGAATTTGCGAATGAATTATTTC
GTGCACTTGCTCGGAGACATAACACAAATGGTGATTCAATTAACAAGGCACAGCTTAGACAGTTCTGGGATCAGATTGCTGATGAAAGCTTTGACTCTAGGCTCCAAACATTCTTTGACA
T
GTAAAGTGTTTAATATTAGTTGAACGGTTCTTTTTCCCTCTGAATTGTTGTCTATGTTGTTGATTAACAGTGACGTGTTTAATATTCGATAATCTGTGCAGGGTTGATAAAGATGCTGA
TGGAAGAATAACAGAAGAAGAAGTTTTGGAG
GTAAGCTTCGAATGAATATTTTATTAACGTGGACCCGTTCAAACCAACCAAAAAAACATCACTCAATATGCACGATTCTTCTTCTTCTT
TTCGACAAGATGAACGGAATAAATTAATCGTGATTGTTTTATCGACTTTATTTCTTACATACCATTAGCAGTTGTGATTGACCATATCAAATTTATTTGTAGATTATCAGTCTAAGTGCT
TCTGCAAACAAGCTCTCCAACATTCAGAAACAAGCCAAGGAGTATGCTGCACTGATTATGGAAGAATTAGACCCAGATAATGCTGGATACATCATG
GTACAGCACACAAAAGTTTCCTAT
AATTAAACGACAGCAAATGTTCATTTATTTTTCCGGGCATAATTATTATTATTTTTAAAATAATATAAATTATATCTTAAAATTTTACTATAGATTATGTTTTTAAATTGAACTGTTTTT
TTAATATAATATCATAGATTTTTGACATGAAAATTGTTGTTTTCGTGTCAATAAACAGATTTATAACTTGGAAACATTACTATTGCAAGCTTCAACCCAATCCTTCAGAGTTAGCGATAG
CCGAGTTCTGAGTGAATTACTTAGCCAAAAGCTGAAGCCTACACAAGAGAACAATCCATTAAAGAGATGGTACCCAAAAGTCAAGTACTTTTTGATGGATAACTGGCAGAGAGTTTGGAT
AATGATGTTGTGGATGGGTATCGTTGCCGGTTTATTTACTTACAAGTTCATAGAGTATCGACACAATAAGGCCGCATACGATGTAATGGGCTATTGCGTTTGTGTTGCCAAAGGAGGGGC
AGAGACCCTTAAATTCAATATGGCCTTGATTTTACTACCAGTCTGCCGGAACACCATTACTTGGCTGCGAAACAAGACCAAATTGGGAGTAGCTGTGCCTTTTGATGACAATCTAAATTT
CCACAAG
GTAATGAAACTAATCTATTCCATATTATGTTCGAGAAGTCTGCATGATCTTAAAATCTAAGGATGCTTGTTATGATTTGTTTAGGTTATTGCAGTAGGAATTGCCATTGGAAC
TGGATTACATGCAGGGGCTCATATAACGTGTGATTTTCCCCGACTTCTTCACGCCACTGAAAAAGAATACGAGCCTCTGAAACCTTACTTTGGAGATGAGCAACCTGATAACTACGGGTG
GTTTTTGAAAGGTGTGGAGGGGATCACAGGCATTATAATGGTAGTGCTAATGGCCATAGCATTCACATTAGCCACGCCATGGTTCCGGCGTAACAGGCTCAACCTGCCTAAACCTCTCAA
GAAACTCACTGGCTTCAATGCCTTCTGGTATTCCCACCATCTGTTCGTTATTGTCTACACTCTCCTCGTGGTCCATGGAATTTACCTCTACCTCACAAAGACATGGTATAAGAAAACG
GT
TAGTGCTTTGCTCCTCCCTTGCGTCGCAACTGAATTAAGAATTTGCTTCTTTTCTACCTCTTAAGTTGTTATAAATAAACAATCCATTTCCAATTTTTCTTGACTGCAGACATGGATCTA
CCTAGCAGTGCCGGTTATCCTTTATGCGTGTGAAAGGTTGATCAGGGCTTTTAGATCAAGCACCAGAGCTGTTAAGATTCTCAAG
GTATGGTACAATGAAGTCTATATGAATTACGTACT
ACTTATCTTCAACTTCTACTGGCTAATCTGTACCATACTGAAGACCAGTATTTTGTCCATGAACACTTTACCAGGTTGCCGTCTATCCTGGAAACGTCCTGGCATTGCACATGTCAAAGC
CCCAGGGCTTCAAATACAAAAGTGGGCAGTACATGTTTGTCAACTGCGCTGCAGTTTCTCCATTTCAATG
GTAAGTTAATTTAATTTCCGTGGCAGATTGCTAGCTGGTGCCCACTTAAT
TATGCCAAAGAAACCCAATCCAATTACATTGTATAATTATTGACCTTGGACGCTAATGCATAGTTGGTATGAACACAGGCACCCATTCTCTATCACTTCTTCGCCAGGAGATGACTACCT
GAGCGTGCACATTCGAACACTCGGTGATTGGACGAGGCAACTCCAAACTGTTTTCTCTGAG
GTCTGTTGTTAGCTAATGACTACATCATGCAAACCAAATTTCCTTCGTGTTTTGTTCCG
AACAATCTCTTATGTTTTCAATGGTTGTTAGGTTTGTCAGCCTCCACCTGCTGGGAAGAGTGGATTACTCAGAGCTGATATGCAAGGAGAAAACAATCCTAGGTAAATTAAGATGTCTAA
TCAGCCTTCTTCTTCAATGACTCTTTTCTTTACTTATTCGAGAACTTGTGCCAGTTACATTTATGAGGTTTATGGGCTGTCTCATTTGGAATATTGGTCATCCATAATAGAAGAGTAGTT
TTATTGCCTTGAACATGTCAATGACAAGTGGAGATTAAATGAATGTTGCAGCTTTCCGAAGATATTAATCGATGGTCCATTCGGAGCTCCAGCACAAGAGTACAAGAAATATGATGTGGT
GCTACTCGTAGGGCTTGGCATTGGAGCCACACCTATGGTCAGCATTGTCAAGGACATCATCAACAACAAGAAACTTAAGGACAAGGATGGAGAGGATAATGGCGCACTAGAGGGCTTGGA
AAGTGGCAGAGGACCACCCAATAAGAACAAGATTAGTACTAGCAGAAGTTTCAAAACAAGAAAAGCATATTTCTATTGGGTCACGAGGGAACAAGGTTCATTCGAGTGGTTCAAAGAGAT
AATGAATGAGGTGGCAGAGATGGACGACAAGCAGGTGATAGAAATGCACAACTATTGCACAAGTGTATATGAAGAAGGGGATGCAAGGTCTGCCCTCATTGCAATGCTCCAGTCATTAAA
CCATGCCAAGAATGGCGTGGATGTGGTTTCAGGCACACGGGTCAAATCCCACTTTGCCAAACCCATCTGGCGACAAGTTTACAAGAAAATCGCTCTCCGACATCCAGATGCTCGAATTG
G
TCAGTTCACCTACCCTTGCCCACCCACTTCGTTGGGCCCTCCTTCTCCTTTTTTTTTTTTTTTTTTGTCTGTCCACGAAACTAAAAAGATCTTACAAACTAATCAATTCCGTGTCAACAT
TTACGAGCAGGAGTTTTCTACTGCGGGGCACCAGCACTTACAAAGGAGCTAAGGCAACTGGCTCTAGACTTCTCTCACAAGACCTCTACGGAGTTTGATTTTCATAAAGAAAACTTTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATCAGAAGCGAGGGCTTGAGGGGAGCTTATTCTGAGGACAGTTCGGACACAGAAAGCACAGCAAGTGACAGAACAGCTTTTAGTGGGCCTTTAGGTTCAGGAGGAGGAGGACTTCTC
AATAAAAAGCATTCTTCCAAGAAGAGCGCGGGGTTCAATATTCCTCCTGAAACCACCATAAATTCCGGCTTCACTGACGATTCATCTTCCTTTGTAGAGATTACTTTGGATATTTGTGAC
GATTCTGTGGCGGTTCACAGCGTTCAGGGTGCTAATGAGGATCCCGAATTGACTTTGCTGGCGAAGACAGCGCTAGAGGGAAACAATTCCTCTTCGCTGCGGTCTTCCTTGTTTAGGAAC
ACATCGTCCAAAATCAGGCAGGTCTCTCAGGAGCTAAAACGTTTCGCTTCAAGAAGGTCATCCACAGCTAGACGGTTTGATAGGACTAAGTCAGCTGCTGCTCATGCCTTGAAGGGACTT
AAGTTCATTACTGCTAAAACTGGAAATGGATGGCCTGCTGTTGAGAAGCGATTTCAAGAACTTACTGCCTCTACCGATGGCCTCCTTCCATGTTCCTTGTTTGGCGAATGCATAG
GTATG
AACAAGGACTCTAAGGAATTTGCGAATGAATTATTTCGTGCACTTGCTCGGAGACATAACACAAATGGTGATTCAATTAACAAGGCACAGCTTAGACAGTTCTGGGATCAGATTGCTGAT
GAAAGCTTTGACTCTAGGCTCCAAACATTCTTTGACAT
GGTTGATAAAGATGCTGATGGAAGAATAACAGAAGAAGAAGTTTTGGAGATTATCAGTCTAAGTGCTTCTGCAAACAAGCTC
TCCAACATTCAGAAACAAGCCAAGGAGTATGCTGCACTGATTATGGAAGAATTAGACCCAGATAATGCTGGATACATCATG
ATTTATAACTTGGAAACATTACTATTGCAAGCTTCAACC
CAATCCTTCAGAGTTAGCGATAGCCGAGTTCTGAGTGAATTACTTAGCCAAAAGCTGAAGCCTACACAAGAGAACAATCCATTAAAGAGATGGTACCCAAAAGTCAAGTACTTTTTGATG
GATAACTGGCAGAGAGTTTGGATAATGATGTTGTGGATGGGTATCGTTGCCGGTTTATTTACTTACAAGTTCATAGAGTATCGACACAATAAGGCCGCATACGATGTAATGGGCTATTGC
GTTTGTGTTGCCAAAGGAGGGGCAGAGACCCTTAAATTCAATATGGCCTTGATTTTACTACCAGTCTGCCGGAACACCATTACTTGGCTGCGAAACAAGACCAAATTGGGAGTAGCTGTG
CCTTTTGATGACAATCTAAATTTCCACAAG
GTTATTGCAGTAGGAATTGCCATTGGAACTGGATTACATGCAGGGGCTCATATAACGTGTGATTTTCCCCGACTTCTTCACGCCACTGAA
AAAGAATACGAGCCTCTGAAACCTTACTTTGGAGATGAGCAACCTGATAACTACGGGTGGTTTTTGAAAGGTGTGGAGGGGATCACAGGCATTATAATGGTAGTGCTAATGGCCATAGCA
TTCACATTAGCCACGCCATGGTTCCGGCGTAACAGGCTCAACCTGCCTAAACCTCTCAAGAAACTCACTGGCTTCAATGCCTTCTGGTATTCCCACCATCTGTTCGTTATTGTCTACACT
CTCCTCGTGGTCCATGGAATTTACCTCTACCTCACAAAGACATGGTATAAGAAAACG
ACATGGATCTACCTAGCAGTGCCGGTTATCCTTTATGCGTGTGAAAGGTTGATCAGGGCTTTT
AGATCAAGCACCAGAGCTGTTAAGATTCTCAAG
GTTGCCGTCTATCCTGGAAACGTCCTGGCATTGCACATGTCAAAGCCCCAGGGCTTCAAATACAAAAGTGGGCAGTACATGTTTGTC
AACTGCGCTGCAGTTTCTCCATTTCAATG
GCACCCATTCTCTATCACTTCTTCGCCAGGAGATGACTACCTGAGCGTGCACATTCGAACACTCGGTGATTGGACGAGGCAACTCCAAACT
GTTTTCTCTGAG
GTTTGTCAGCCTCCACCTGCTGGGAAGAGTGGATTACTCAGAGCTGATATGCAAGGAGAAAACAATCCTAGCTTTCCGAAGATATTAATCGATGGTCCATTCGGAGCT
CCAGCACAAGAGTACAAGAAATATGATGTGGTGCTACTCGTAGGGCTTGGCATTGGAGCCACACCTATGGTCAGCATTGTCAAGGACATCATCAACAACAAGAAACTTAAGGACAAGGAT
GGAGAGGATAATGGCGCACTAGAGGGCTTGGAAAGTGGCAGAGGACCACCCAATAAGAACAAGATTAGTACTAGCAGAAGTTTCAAAACAAGAAAAGCATATTTCTATTGGGTCACGAGG
GAACAAGGTTCATTCGAGTGGTTCAAAGAGATAATGAATGAGGTGGCAGAGATGGACGACAAGCAGGTGATAGAAATGCACAACTATTGCACAAGTGTATATGAAGAAGGGGATGCAAGG
TCTGCCCTCATTGCAATGCTCCAGTCATTAAACCATGCCAAGAATGGCGTGGATGTGGTTTCAGGCACACGGGTCAAATCCCACTTTGCCAAACCCATCTGGCGACAAGTTTACAAGAAA
ATCGCTCTCCGACATCCAGATGCTCGAATTG
GAGTTTTCTACTGCGGGGCACCAGCACTTACAAAGGAGCTAAGGCAACTGGCTCTAGACTTCTCTCACAAGACCTCTACGGAGTTTGAT
TTTCATAAAGAAAACTTTTAA

Retrieve as FASTA