Entry information : PtRboh04 (POPTR_0003s15810)
Entry ID 6074
Creation 2008-01-28 (Christophe Dunand)
Last sequence changes 2010-09-28 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtRboh04 (POPTR_0003s15810)
Name (synonym) PtRboh04 (POPTR_0003s15810)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtRboh04
start..stop
S start..stop
PtRboh01 1691 0 1..926 1..926
CsRboh02 1557 0 2..926 1..912
CclRboh02 1557 0 2..926 1..912
VvRboh03 1515 0 13..926 5..924
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 15512163..15512760 598 N° 2 15512855..15513017 163 N° 3 15513134..15513182 49 N° 4 15513487..15513600 114
N° 5 15513692..15514117 426 N° 6 15514201..15514587 387 N° 7 15514706..15514801 96 N° 8 15514914..15515029 116
N° 9 15515139..15515241 103 N° 10 15515340..15515410 71 N° 11 15515599..15516146 548 N° 12 15516272..15516381 110
join(15512163..15512760,15512855..15513017,15513134..15513182,15513487..15513600 ,15513692..15514117,15514201..15514587,15514706..15514801,15514914..15515029,155 15139..15515241,15515340..15515410,15515599..15516146,15516272..15516381)


exon

Literature and cross-references PtRboh04 (POPTR_0003s15810)
Literature JGI.
DNA ref. Phytozome 11:   scaffold_3 (15512163..15516381)
EST ref. UniGene:   Pth.14199 [3' end]
Protein sequence: PtRboh04 (POPTR_0003s15810)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   0
PWM (Da):   %s   Transmb domain:   %s   o364-386i507-529o549-571i730-747o
PI (pH):   %s   6.11
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MIRGEDSRGAYSENNSDTESIASDRTAFSGPLGSGGGGALNKKRSSRKSARFNIPTETVINSGVPDDPSSYVEITLDIREDSVAVHSVQGANEDPELTLLAKTALEGNNSSSLRSSLFRNTSSRIRQVSQELKRFASLSRRTSTRRFDRNKSAAAHALKGLKFITTKTGNGWPAVEKRFQGLTASTSGLLPCSLFGECIGMNKDSKEFAGELFRALARRHNINSDLINKAQLRQFWDQISDESFDSRLQIFFDMVDKDADGRIAEEEVLIITLSASANKLSNIQKQAKEYAALIMEELDPDNAGYIMIYNLETLLLQAPNQTVRVGDSKVLSQLLSQKLKPTQENNPLKRWYQKMKYFLMDNWQRVWIMMLWMGIVAGLFTYKFIQYRHKAAYDVMGYCVCVAKGGAETLKFNMALILLPVCRNTITWLRNKTKLGVAVPFDDNLNFHKVIAVGIAIGIGLHAGAHLTCDFPRLIHATEEEYEPMKPYFGDDQPENYWWFLKGVEGITGVVMVVLMAIAFTLATPWFRRNRINLPKPLKKLTGFNAFWYSHHLFVIVYTLLVVHGIYLYLTKTWYHKTTWMYLAVPVILYACERLIRAFRSSIRAVKILKVAVYPGNVLALHMSKPQGFKYKSGQYMFVNCAAVSPFEWHPFSITSAPGDDYLSVHIRTLGDWTRQLKTVFSVCQPPTAGKSGLLRADMQGGNNPSIPKILVDGPFGAPAQDYKKYDVVLLVGLGIGATPMISIVKDIINNMKIKDKDEGNNGALDALESGRATPNKNNKINSKSFKTRKAYFYWVTREQGSFEWFKGIMNEVAEMDDKQVIELHNYCTSVYEEGDARSALIAMLQSLHHAKSGVDVVSGTRVKSHFAKPNWRQVYKKIALQHPDSRGVFYCGAPALTKELRQLALDFSRKTSTKFDFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 3, 11 introns) and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATCAGAGGCGAGGACTCGAGGGGTGCTTATTCTGAGAACAACTCGGACACAGAAAGCATAGCAAGCGACAGAACAGCTTTTAGTGGGCCATTAGGATCAGGAGGAGGAGGAGCTCTC
AATAAAAAACGTTCTTCAAGGAAGAGCGCGAGGTTCAATATTCCTACTGAAACCGTTATAAATTCCGGTGTTCCTGATGATCCATCTTCCTATGTAGAGATTACTTTGGATATTCGTGAA
GATTCTGTGGCAGTTCACAGCGTTCAAGGAGCTAATGAGGATCCCGAATTGACTCTGCTGGCGAAGACTGCGCTGGAGGGTAACAATTCCTCTTCGCTGCGGTCTTCGCTGTTTAGGAAC
ACATCATCCAGAATCAGACAGGTCTCTCAGGAGCTAAAACGTTTTGCTTCTTTATCAAGAAGGACATCTACTAGACGGTTTGATAGGAATAAGTCAGCTGCTGCTCATGCCTTGAAGGGA
CTTAAGTTCATTACCACCAAAACTGGAAATGGATGGCCTGCTGTTGAGAAGCGATTTCAAGGACTTACTGCTTCTACCAGTGGCCTACTTCCCTGTTCCTTGTTTGGAGAATGCATTG
GT
AAGTACCCTTGTTGGCTATTAATTTTCTCGTTAATCTCCTGCTTCAATTAACTATGATGCTAATTATTGACCACTATATTTATACACGACAGGTATGAACAAGGACTCTAAGGAATTTGC
CGGAGAATTATTTCGTGCACTTGCTCGGAGACATAACATAAATAGTGATTTAATTAACAAGGCACAGCTTAGACAATTCTGGGATCAAATTTCCGATGAAAGCTTTGACTCCAGGCTCCA
GATCTTCTTTGACAT
GTATACTTTCAATTAACATTGCGTTCTTCAATATTGATTGAGCGCTTTTTATCCTTTGGGATTGCCGCCTGTCTTGTTGCCTGCTCTTAAGTGTTTAATATTGAT
AATATGTGCAGGGTTGATAAAGATGCTGATGGAAGAATAGCAGAAGAGGAAGTTTTGGAAGTAAGCGATCAAATGAATATTTTAATAGTGTATTATTGGTTGTTTTTTAAAATATATTAA
AATAATATTTTTTATTTTTTAAAATTTATTTTTTATATAAACACAACTTAAAAATATTTAATTTGAAGAAAAAAAATCAAATTCTAGCACCGTTCAAACTCTAAAAAAAAAAAAAAACTT
TTGCATCTCTGTTTTTTTTTTTTAACATAAGGTGAACAGAATGAATTAATTTTGGTTGATATAACGACTTTATTTCTTAAATAACATTACTAGTTGTGATTGACCGGATCAAATTTATTT
GTAGATTATCACTCTAAGTGCTTCTGCAAACAAGCTTTCCAACATTCAGAAACAAGCCAAGGAGTATGCAGCACTAATCATGGAAGAATTAGACCCAGATAATGCTGGATATATCATGGT
ACAGTACATAAAAGTGTAATTAAACAATCATATAGGTTCATTTATCTTTCCGGGCATAATTAATTTCTTGTTTTGGTGGCAATAAACAGATTTATAACTTGGAAACACTATTATTGCAAG
CTCCAAACCAAACCGTCAGAGTTGGAGATAGCAAAGTTCTGAGTCAATTATTGAGCCAAAAGCTGAAGCCCACACAAGAAAACAATCCATTAAAGAGATGGTACCAAAAGATGAAGTACT
TTTTGATGGATAATTGGCAGAGAGTTTGGATAATGATGTTGTGGATGGGAATCGTCGCTGGTTTATTTACTTACAAGTTCATACAATATCGGCACAAGGCCGCATATGATGTGATGGGTT
ATTGCGTTTGTGTTGCCAAAGGAGGGGCAGAGACCCTTAAATTCAATATGGCCTTGATTTTACTACCAGTCTGCCGGAATACCATTACTTGGCTCAGAAACAAGACCAAATTGGGTGTTG
CTGTGCCTTTTGATGACAATCTGAATTTCCACAAG
GTAACGAGACTTCTGTAATCCTTGTATTTGAGAAGTCTGCGTGATCTTAAAAATCTAATAATACTTGCTATAAATTTGTTCAGGT
TATTGCAGTAGGAATTGCCATTGGAATTGGATTGCATGCAGGGGCTCATTTAACGTGTGATTTTCCACGACTTATTCATGCCACTGAAGAAGAATACGAGCCTATGAAACCTTACTTTGG
AGATGATCAGCCTGAAAACTACTGGTGGTTTTTGAAAGGTGTGGAGGGGATCACAGGCGTTGTAATGGTAGTGCTAATGGCCATAGCATTCACATTAGCCACGCCTTGGTTTCGGCGTAA
CAGAATCAACCTGCCTAAACCTCTCAAGAAACTCACTGGCTTCAATGCGTTCTGGTATTCCCACCATCTGTTCGTTATTGTCTACACTCTCCTTGTTGTCCATGGAATTTACCTCTACCT
CACAAAGACATGGTATCATAAAACG
GTCAGTGCTTCACTCCTCCCTTTCGTTGCAACTAAAATTAAGAATTTGCTTCCTTTTGACCTTTCAGATATTTCTTGTACATTTACAATCGATTT
CCATCTTCTCTTGAGTGCTGCAGACATGGATGTATCTAGCAGTGCCGGTTATTCTTTATGCATGTGAAAGGTTGATCAGGGCTTTCAGATCAAGCATCAGAGCCGTTAAGATCCTCAAGG
TCTAATTCAATGAAGTCTCTATGAATTGATCACTACTCATTTTCAAATTCTAGTACTGGCAAAACTTGTACAATACTGAAGACCACTATTTTTTCATGAACATTTTATTAGGTTGCCGTC
TATCCGGGAAACGTCCTGGCATTGCACATGTCAAAGCCCCAAGGATTCAAATACAAGAGTGGGCAGTACATGTTTGTCAACTGCGCTGCAGTTTCTCCCTTTGAATG
GTAAGAATCTAAT
TTCTGTGGCAGATAGCTAGCTAGCGCCCACTTCAGCCCAAGAAATCCAATTATTTTGGCCTTCGACACTAATGCATAATAATTGGTATGAACACAGGCACCCATTTTCTATCACTTCAGC
ACCAGGAGATGACTACCTAAGCGTGCACATTCGAACACTCGGTGATTGGACGAGGCAACTCAAAACTGTTTTCTCTGAG
GTCTGTCGTTAGCTACATTTATATATGCTGCATGCCAAACC
AAATTCCCTTCTTGCTTGGTTCTGAACAATCTCTTATATGTTTTCAATGGTTGTTAGGTTTGCCAGCCTCCGACTGCTGGGAAGAGTGGATTGCTCAGAGCTGATATGCAAGGAGGAAAC
AATCCTAG
GTAATAATTAATTATGATATCTTGGTGGAAGGTGTTGAATTGATGATAAGCTATTAAAATCATATATATATACTTTTGACTAAAATCTGTTAGTGATTCAATAGCGATGGCA
TGATCATCGATAATAGTAGCACAATTTTATTGCCTTGAGCATTTCATTGACAAGTGGCGATTAAATTAATGTACAGCATTCCCAAGATATTAGTTGATGGTCCATTTGGAGCTCCGGCAC
AAGACTACAAGAAGTATGATGTGGTGCTACTAGTAGGGCTTGGCATCGGAGCCACACCTATGATCAGCATAGTCAAGGACATTATCAACAACATGAAAATCAAGGATAAGGATGAAGGGA
ATAATGGAGCCTTGGATGCGTTGGAAAGTGGCAGAGCCACGCCTAATAAGAACAACAAGATTAATAGCAAAAGTTTCAAAACAAGAAAAGCATACTTCTATTGGGTCACAAGGGAACAGG
GTTCCTTTGAGTGGTTCAAAGGGATAATGAATGAGGTGGCAGAGATGGATGACAAGCAGGTGATAGAATTGCACAACTACTGCACAAGTGTTTATGAAGAAGGCGATGCAAGGTCAGCTC
TCATTGCCATGCTCCAGTCGCTACACCATGCCAAGAGCGGCGTGGATGTGGTTTCAGGCACACGGGTCAAATCCCACTTTGCCAAACCCAACTGGCGACAAGTCTACAAGAAGATCGCCC
TTCAGCATCCAGATTCTCGAATTG
GTCAGTTCTGCTAACCGTGCTCACCTACTTTTTGTTGGGCCTTTGTTTTTCTCTTCTTTTTGTCCCCCACGGAACTAAGGAAATATTACTTAACTA
AACAACTTCGTGTGTAAAATTATGTGCAGGAGTTTTCTACTGTGGGGCACCAGCACTCACGAAGGAGCTAAGGCAATTAGCTCTAGACTTCTCTCGCAAGACCTCTACAAAGTTCGATTT
TCATAAAGAGAACTTTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATCAGAGGCGAGGACTCGAGGGGTGCTTATTCTGAGAACAACTCGGACACAGAAAGCATAGCAAGCGACAGAACAGCTTTTAGTGGGCCATTAGGATCAGGAGGAGGAGGAGCTCTC
AATAAAAAACGTTCTTCAAGGAAGAGCGCGAGGTTCAATATTCCTACTGAAACCGTTATAAATTCCGGTGTTCCTGATGATCCATCTTCCTATGTAGAGATTACTTTGGATATTCGTGAA
GATTCTGTGGCAGTTCACAGCGTTCAAGGAGCTAATGAGGATCCCGAATTGACTCTGCTGGCGAAGACTGCGCTGGAGGGTAACAATTCCTCTTCGCTGCGGTCTTCGCTGTTTAGGAAC
ACATCATCCAGAATCAGACAGGTCTCTCAGGAGCTAAAACGTTTTGCTTCTTTATCAAGAAGGACATCTACTAGACGGTTTGATAGGAATAAGTCAGCTGCTGCTCATGCCTTGAAGGGA
CTTAAGTTCATTACCACCAAAACTGGAAATGGATGGCCTGCTGTTGAGAAGCGATTTCAAGGACTTACTGCTTCTACCAGTGGCCTACTTCCCTGTTCCTTGTTTGGAGAATGCATTG
GT
ATGAACAAGGACTCTAAGGAATTTGCCGGAGAATTATTTCGTGCACTTGCTCGGAGACATAACATAAATAGTGATTTAATTAACAAGGCACAGCTTAGACAATTCTGGGATCAAATTTCC
GATGAAAGCTTTGACTCCAGGCTCCAGATCTTCTTTGACAT
GGTTGATAAAGATGCTGATGGAAGAATAGCAGAAGAGGAAGTTTTGGAAATTATCACTCTAAGTGCTTCTGCAAACAAG
CTTTCCAACATTCAGAAACAAGCCAAGGAGTATGCAGCACTAATCATGGAAGAATTAGACCCAGATAATGCTGGATATATCATG
ATTTATAACTTGGAAACACTATTATTGCAAGCTCCA
AACCAAACCGTCAGAGTTGGAGATAGCAAAGTTCTGAGTCAATTATTGAGCCAAAAGCTGAAGCCCACACAAGAAAACAATCCATTAAAGAGATGGTACCAAAAGATGAAGTACTTTTTG
ATGGATAATTGGCAGAGAGTTTGGATAATGATGTTGTGGATGGGAATCGTCGCTGGTTTATTTACTTACAAGTTCATACAATATCGGCACAAGGCCGCATATGATGTGATGGGTTATTGC
GTTTGTGTTGCCAAAGGAGGGGCAGAGACCCTTAAATTCAATATGGCCTTGATTTTACTACCAGTCTGCCGGAATACCATTACTTGGCTCAGAAACAAGACCAAATTGGGTGTTGCTGTG
CCTTTTGATGACAATCTGAATTTCCACAAG
GTTATTGCAGTAGGAATTGCCATTGGAATTGGATTGCATGCAGGGGCTCATTTAACGTGTGATTTTCCACGACTTATTCATGCCACTGAA
GAAGAATACGAGCCTATGAAACCTTACTTTGGAGATGATCAGCCTGAAAACTACTGGTGGTTTTTGAAAGGTGTGGAGGGGATCACAGGCGTTGTAATGGTAGTGCTAATGGCCATAGCA
TTCACATTAGCCACGCCTTGGTTTCGGCGTAACAGAATCAACCTGCCTAAACCTCTCAAGAAACTCACTGGCTTCAATGCGTTCTGGTATTCCCACCATCTGTTCGTTATTGTCTACACT
CTCCTTGTTGTCCATGGAATTTACCTCTACCTCACAAAGACATGGTATCATAAAACG
ACATGGATGTATCTAGCAGTGCCGGTTATTCTTTATGCATGTGAAAGGTTGATCAGGGCTTTC
AGATCAAGCATCAGAGCCGTTAAGATCCTCAAG
GTTGCCGTCTATCCGGGAAACGTCCTGGCATTGCACATGTCAAAGCCCCAAGGATTCAAATACAAGAGTGGGCAGTACATGTTTGTC
AACTGCGCTGCAGTTTCTCCCTTTGAATG
GCACCCATTTTCTATCACTTCAGCACCAGGAGATGACTACCTAAGCGTGCACATTCGAACACTCGGTGATTGGACGAGGCAACTCAAAACT
GTTTTCTCTGAG
GTTTGCCAGCCTCCGACTGCTGGGAAGAGTGGATTGCTCAGAGCTGATATGCAAGGAGGAAACAATCCTAGCATTCCCAAGATATTAGTTGATGGTCCATTTGGAGCT
CCGGCACAAGACTACAAGAAGTATGATGTGGTGCTACTAGTAGGGCTTGGCATCGGAGCCACACCTATGATCAGCATAGTCAAGGACATTATCAACAACATGAAAATCAAGGATAAGGAT
GAAGGGAATAATGGAGCCTTGGATGCGTTGGAAAGTGGCAGAGCCACGCCTAATAAGAACAACAAGATTAATAGCAAAAGTTTCAAAACAAGAAAAGCATACTTCTATTGGGTCACAAGG
GAACAGGGTTCCTTTGAGTGGTTCAAAGGGATAATGAATGAGGTGGCAGAGATGGATGACAAGCAGGTGATAGAATTGCACAACTACTGCACAAGTGTTTATGAAGAAGGCGATGCAAGG
TCAGCTCTCATTGCCATGCTCCAGTCGCTACACCATGCCAAGAGCGGCGTGGATGTGGTTTCAGGCACACGGGTCAAATCCCACTTTGCCAAACCCAACTGGCGACAAGTCTACAAGAAG
ATCGCCCTTCAGCATCCAGATTCTCGAATTG
GAGTTTTCTACTGTGGGGCACCAGCACTCACGAAGGAGCTAAGGCAATTAGCTCTAGACTTCTCTCGCAAGACCTCTACAAAGTTCGAT
TTTCATAAAGAGAACTTTTAA

Retrieve as FASTA