Entry information : PtRboh10 (POPTR_0005s02630 / Potri.005G026200)
Entry ID 6075
Creation 2008-01-28 (Christophe Dunand)
Last sequence changes 2010-07-13 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtRboh10 (POPTR_0005s02630 / Potri.005G026200)
Name (synonym) PtRboh10 (POPTR_0005s02630 / Potri.005G026200)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtRboh10
start..stop
S start..stop
CsRboh03 1575 0 1..886 1..889
CclRboh03 1574 0 1..886 1..889
GmRboh15 1526 0 1..886 1..871
GmRboh02 1526 0 1..886 1..885
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1676273..1676780 508 N° 2 1675853..1676012 160 N° 3 1675143..1675191 49 N° 4 1674940..1675053 114
N° 5 1674300..1674728 429 N° 6 1673823..1674209 387 N° 7 1673606..1673701 96 N° 8 1673148..1673263 116
N° 9 1672943..1673045 103 N° 10 1672740..1672813 74 N° 11 1672133..1672647 515 N° 12 1671884..1671993 110
complement(join(1671884..1671993,1672133..1672647,1672740..1672813,1672943..1673 045,1673148..1673263,1673606..1673701,1673823..1674209,1674300..1674728,1674940. .1675053,1675143..1675191,1675853..1676012,1676273..1676780))


exon

Literature and cross-references PtRboh10 (POPTR_0005s02630 / Potri.005G026200)
DNA ref. Phytozome 11:   scaffold_5 (1676780..1671884)
Omic ref. ePlant:   Potri.005G026200
Protein sequence: PtRboh10 (POPTR_0005s02630 / Potri.005G026200)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   0
PWM (Da):   %s   Transmb domain:   %s   o337-356i477-499o519-541i701-718o
PI (pH):   %s   6.11
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEIQENQQDSLSETESNTSSTRIGYSGPLSGPLVTTTKKNSSKKSARFKDEEYVEITLDVRDDSVSVQNIKGGDSETAYLASQLGRKHPSLGSQLSIKLRQVSHELKRMTSSKRFDKYDRSKSGAARALKGLKFMTKNVGSEGWSEIEARFHELAVNGSLPKSKFGQCIGMKESSEFASELFDALARRRGITTPSIIKAELYEFWQQITDQRFDARLQTFFDMVDKDADGRITEEEVKIIALSASANKLSKIQERAEEYAALIMEELDPDNLGFIELYNLEMLLLQAPSQSTNLGTDSRVLSQLLSQKLVPTKDHNPIKRGYRGLSYFVEDNWKRIWVIGLWLAVCAALFTWKFVQYKHRAVFDVMGYCVTTAKGAAETLKFNMALILLPVCRNTITWLRSKTKLGMAVPFDDNINFHKVIALGIAIGVGLHAGAHLTCDFPRLLHATDDEYEPMEQFFGKDRPDDYWWFVKGTEGWTGVVMVVLMAVAYTLAQPWFRRNRLSLPKTLKKLTGFNAFWYSHHLFVIVYALFIIHGYYLYLSKKWYKKTTWMYLAVPILLYTCERLTRAFRSGYKTVRILKVAVYPGNVLALHMSKPQGFRYTSGQYVFVNCSAVSTFQWHPFSITSAPGDDYLSIHIRTLGDWTSQLKAVFSVCQPASIHQSGLLRADMAQRDNQPRLPRLLIDGPYGAPAQDYKKYDVLLLVGLGIGATPLISIVKDVLNNIKQQKEMEEGLVESGIKGNYRKPFATKRAYFYWVTREQGSFEWFRGVMNEVADYDQDRVIELHNYCTSVYEEGDARSALITMLQSLQHAKSGVDIVSETRVKTHFARPNWRKVFKHVAVNYPDQRGVFYCGAPGLTGELRRLAQDFSRKTTTKFDFHKENF

Retrieve as FASTA  
Remarks Complete sequence from (chromo 5, 11 introns). No EST. Incorrect prediction from Phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGATTCAAGAAAACCAACAAGATTCATTGTCAGAGACAGAAAGCAATACTAGCAGCACAAGAATTGGTTACAGTGGTCCGCTAAGCGGTCCATTGGTGACCACCACCAAGAAAAAC
AGCAGCAAGAAAAGCGCAAGATTCAAAGATGAAGAATACGTTGAAATCACTCTAGATGTTCGCGATGATTCAGTTTCTGTGCAGAACATCAAGGGAGGTGATTCAGAGACAGCATATCTT
GCTAGCCAGTTGGGGAGAAAGCACCCTTCACTTGGATCACAACTCTCTATTAAGCTAAGGCAGGTTTCACATGAACTTAAAAGAATGACATCTTCTAAAAGGTTTGACAAGTATGATAGA
AGCAAGTCTGGAGCTGCTCGTGCCCTGAAAGGGCTAAAGTTCATGACCAAAAATGTTGGAAGTGAAGGTTGGTCTGAAATTGAAGCAAGGTTTCATGAATTGGCTGTAAACGGATCTCTT
CCAAAATCAAAATTCGGCCAATGTATAG
GTATGTGATGGTGAGATGATAGAGTTATTATAATTTAATCAAGGATAATACATTTTGATCATGTCATGAAATCTTCTTCTATGCATGTTAAA
ATCATGAAAGGGAGAAACATTCATGTTCTGAATGCATGAATTTTGTGTTTTTTAGAGTGATTATATGCTCGTCCTTTCATTATTTTTTAAAAAAAAATGGAAAAGAAAAAAATATTGTTC
GATAGATATGGACTTACTGCTGACAAAATATGGTGGTAATGTGATCAGGGATGAAAGAATCAAGTGAATTTGCAAGCGAATTGTTTGATGCATTAGCTCGGAGGAGAGGCATAACAACAC
CTTCAATAATCAAGGCTGAATTGTATGAATTCTGGCAACAAATTACAGATCAGAGATTTGATGCTAGGCTACAGACCTTCTTTGACAT
GTAAGAGCCTCCCACTATTTTATACTCTTTAT
GTGTGTGTTTTATAATTACTAAATTATTGATTTAACCAGTAAACTTGATAATTTGTTGACTTAGAGCCTGATTTGGCAGGTTGATCTAATGATTTTGTGTGTGTGGAGTGGGGGGTATTA
TAATTACTAAACCTGAATTAGCCTCATAGGTAAATTTAATAGAATATGATTTGACAGATCGATATGATGATCTTGTGTGTTTATGTATGGAGGGAGGATATTATAGATATTAAACTTGAA
TTGGTTTAGCGGGTGATAACTCGTTAATTTAAAATTTAGTTTGACAAATTAATATAATGATTCACTAATTTAAAACTTAGCATAACTTGAAATTTTTTTAAATGTTTCGGATATTAACCC
GGTCAAATCCAGATAATATGAGAGGTCAACTTTCAACCCTGTAAAACTAGACAAAACTTAGGTGAGACTTTACCATGAAAAAAAATATCAACAATATATATCATGCAAGCAATCAAAACC
GGGATTCTAAGCACACGGGCATGCATGTGAAACCACTCTTTCCTATTTGTTTAGCTTAATAATTTTTAGCAAAGATCAAGGATATTGATGTCGACAACTTATCTTATAAATATATTACGA
GTTGTTTGCCTAACATACGCCTGATGCAGGGTGGACAAAGATGCAGATGGTAGGATCACTGAAGAGGAGGTGAAAGAGGTGAGATCAATATTGAAAAATGGAATGCCAAAAATAAAAGAA
TCATAACATTACATTGACTGGACATTTGTTTTATTTGAATCTTGCAGATTATTGCTTTAAGTGCTTCTGCTAACAAGTTATCAAAGATTCAAGAACGTGCAGAGGAGTATGCAGCTCTAA
TCATGGAAGAGCTGGACCCTGACAACCTTGGATTCATCGAG
GTTTATATTCGAAACTCCTCTGTTTCTTTCCTTGGTCTGAAAGTTTGATCAACCAAGCCAGCCTCAGTCCATTCTTAAG
GGCTCTAATTTGTCAAAACGGCTAACAATGGGCTTTCAATTTGATGGCAGCCCAATCTTGATCACCCCCTCTAGCCCCTTTATGGCCTGGCCTAATTCTATAAGCAAACTAATTTTATGT
GTGTTCATGCAGCTGTACAACTTGGAAATGCTCCTTCTCCAAGCTCCAAGCCAATCGACAAACCTAGGAACCGATAGTCGCGTTTTAAGCCAACTTCTAAGCCAAAAACTTGTGCCAACT
AAAGATCATAACCCCATCAAGAGAGGTTATCGGGGGCTATCCTACTTCGTCGAGGACAATTGGAAGAGAATTTGGGTCATTGGCCTGTGGCTTGCAGTCTGTGCTGCTCTGTTCACATGG
AAATTCGTTCAATATAAGCACCGTGCAGTTTTCGATGTCATGGGCTATTGTGTCACCACAGCTAAAGGTGCAGCTGAGACACTTAAATTCAACATGGCATTGATTCTTCTACCAGTTTGT
AGAAATACCATTACTTGGCTTCGAAGCAAGACCAAGTTAGGAATGGCTGTTCCCTTTGATGATAACATCAATTTCCATAAG
GTACGATCCGTACAAGAAAATGGGAAATTTTTTACTTTT
TTGGTTCATTCAGGTCTGAGTTGTATAATTTATTCGGCTTGCATTTTGCAGGTAATTGCTCTAGGAATTGCTATAGGAGTTGGGCTACATGCTGGCGCCCATCTTACATGTGACTTTCCT
AGGCTGCTACATGCCACCGATGACGAGTACGAGCCAATGGAGCAATTCTTTGGCAAGGACCGGCCTGATGACTACTGGTGGTTTGTGAAAGGGACCGAGGGTTGGACCGGAGTGGTGATG
GTGGTGCTAATGGCCGTAGCCTATACACTAGCCCAACCTTGGTTCCGCCGGAATAGGCTAAGCCTTCCTAAAACCCTAAAGAAGCTAACAGGATTCAACGCCTTTTGGTATTCACATCAC
TTATTTGTTATTGTCTACGCCCTCTTCATCATCCACGGATACTATCTTTACCTCTCCAAGAAATGGTACAAGAAAACG
GTAAGCTTCTTGTAAACAAATACAACATTTGTAATTAAGCCA
CTTCAATCATTGGATTAACACTAACAATTATACTTAATCACCTTAACTTTGTCTAATGATCTTGCATTGCCTTTGACAGACATGGATGTATCTTGCTGTCCCAATTCTATTATACACATG
TGAACGTTTGACCCGTGCTTTTCGATCAGGTTATAAAACCGTACGAATATTAAAG
GTACGTGTTTATTTAATAATTAATATTTTATGCACGTTATTAAATTCAGTTGAGTTCCGCGCGCT
AATTCAATTGCCTGTTTATCAGACCTAGCTTGTATTAAAATTTAAATTAAATCAAGTGAGAGTTAAATTAATAAAACCTAATTAATGTGACAGGTGTGACTCCGTCATATTTTTATTTGA
ATTTTAATTTGTTTTTCAAAAAAATATTATTTTGGATTGATCTGAGTCAAGCCATCCAACTGGGTTTAATGACTTTGATTTAAAATAATTAATCTTTGGATTTGGTGATTAATTAAGAAT
CAAAACTGACATACATGTTTCTATCTTCAAAATTCAGGTTGCAGTGTACCCTGGAAATGTACTAGCACTGCATATGTCAAAACCACAAGGATTTCGATACACCAGTGGGCAATATGTGTT
TGTAAATTGTTCTGCTGTTTCTACATTTCAATG
GTAACGATTAATCTTCTTTCAGTGCGTCTCTGTTTTTTCACTTGATTTTTTTTTAACGTGGACATATAATGAAGCAAAAATATATGC
TGGTGTGCATTTCAGGCATCCATTTTCAATCACTTCTGCTCCTGGAGATGATTATTTGAGCATCCATATTCGAACCTTAGGTGACTGGACATCGCAACTCAAAGCTGTTTTTTCTAAGGT
ATTCTTCGGCAAGAACTGCTCCAAAATTTCGATCACTCTTATACTCCCCAATTCTTGGAAAATTTCCTTTCACACAGCTAAACATTTTGCTCCTCTCATTGTTTTGTCTTGTGGGGTGCA
ATTGTAGGTGTGTCAGCCGGCATCAATACACCAAAGTGGCCTTCTAAGAGCCGATATGGCACAACGCGATAATCAACCTAGGTAATTGCTGATTTCTTTCTCATTGACACTTGCTTTTTA
AGCAATTATTTGAATTTGAGTTGTATCATAGTAATGATCCTGTACATTAGCAGGTTGCCAAGGCTGCTAATTGATGGACCTTATGGGGCACCAGCACAGGACTACAAGAAATACGATGTT
CTCCTTCTTGTTGGACTTGGCATTGGTGCCACCCCTCTAATAAGCATAGTCAAAGATGTGCTTAACAACATCAAGCAGCAAAAGGAAATGGAAGAGGGGTTAGTAGAAAGTGGTATCAAG
GGCAACTACAGAAAGCCTTTCGCAACCAAACGAGCTTACTTCTATTGGGTCACTCGCGAGCAGGGCTCGTTCGAGTGGTTTAGAGGTGTAATGAACGAGGTAGCTGATTATGATCAAGAT
AGAGTCATCGAACTTCATAATTACTGCACAAGTGTTTACGAAGAAGGCGATGCTCGATCAGCTTTAATCACCATGCTTCAATCTCTTCAACATGCTAAAAGTGGCGTCGATATAGTCTCC
GAAACACGAGTTAAGACACATTTTGCCAGGCCTAATTGGCGAAAAGTGTTCAAGCATGTAGCTGTCAATTATCCTGATCAAAGAGTTG
GTAAATTGCCTCTGCATAACACTAATCTTCCA
AGTTTATGTTAACAAAAGAAAAGTCTTCCAAGTTTATGTTAACAAAAGAAAAGGCATTGCATTTCATTATAGCGAACTATGCTAATTGTTGCCTGTTCTTGTTGCAGGAGTGTTTTACTG
TGGAGCACCTGGATTGACTGGAGAACTAAGAAGATTAGCTCAAGATTTCTCCAGGAAAACTACAACCAAATTCGATTTCCATAAAGAGAATTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGATTCAAGAAAACCAACAAGATTCATTGTCAGAGACAGAAAGCAATACTAGCAGCACAAGAATTGGTTACAGTGGTCCGCTAAGCGGTCCATTGGTGACCACCACCAAGAAAAAC
AGCAGCAAGAAAAGCGCAAGATTCAAAGATGAAGAATACGTTGAAATCACTCTAGATGTTCGCGATGATTCAGTTTCTGTGCAGAACATCAAGGGAGGTGATTCAGAGACAGCATATCTT
GCTAGCCAGTTGGGGAGAAAGCACCCTTCACTTGGATCACAACTCTCTATTAAGCTAAGGCAGGTTTCACATGAACTTAAAAGAATGACATCTTCTAAAAGGTTTGACAAGTATGATAGA
AGCAAGTCTGGAGCTGCTCGTGCCCTGAAAGGGCTAAAGTTCATGACCAAAAATGTTGGAAGTGAAGGTTGGTCTGAAATTGAAGCAAGGTTTCATGAATTGGCTGTAAACGGATCTCTT
CCAAAATCAAAATTCGGCCAATGTATAG
GGATGAAAGAATCAAGTGAATTTGCAAGCGAATTGTTTGATGCATTAGCTCGGAGGAGAGGCATAACAACACCTTCAATAATCAAGGCTGAA
TTGTATGAATTCTGGCAACAAATTACAGATCAGAGATTTGATGCTAGGCTACAGACCTTCTTTGACAT
GGTGGACAAAGATGCAGATGGTAGGATCACTGAAGAGGAGGTGAAAGAGATT
ATTGCTTTAAGTGCTTCTGCTAACAAGTTATCAAAGATTCAAGAACGTGCAGAGGAGTATGCAGCTCTAATCATGGAAGAGCTGGACCCTGACAACCTTGGATTCATCGAG
CTGTACAAC
TTGGAAATGCTCCTTCTCCAAGCTCCAAGCCAATCGACAAACCTAGGAACCGATAGTCGCGTTTTAAGCCAACTTCTAAGCCAAAAACTTGTGCCAACTAAAGATCATAACCCCATCAAG
AGAGGTTATCGGGGGCTATCCTACTTCGTCGAGGACAATTGGAAGAGAATTTGGGTCATTGGCCTGTGGCTTGCAGTCTGTGCTGCTCTGTTCACATGGAAATTCGTTCAATATAAGCAC
CGTGCAGTTTTCGATGTCATGGGCTATTGTGTCACCACAGCTAAAGGTGCAGCTGAGACACTTAAATTCAACATGGCATTGATTCTTCTACCAGTTTGTAGAAATACCATTACTTGGCTT
CGAAGCAAGACCAAGTTAGGAATGGCTGTTCCCTTTGATGATAACATCAATTTCCATAAG
GTAATTGCTCTAGGAATTGCTATAGGAGTTGGGCTACATGCTGGCGCCCATCTTACATGT
GACTTTCCTAGGCTGCTACATGCCACCGATGACGAGTACGAGCCAATGGAGCAATTCTTTGGCAAGGACCGGCCTGATGACTACTGGTGGTTTGTGAAAGGGACCGAGGGTTGGACCGGA
GTGGTGATGGTGGTGCTAATGGCCGTAGCCTATACACTAGCCCAACCTTGGTTCCGCCGGAATAGGCTAAGCCTTCCTAAAACCCTAAAGAAGCTAACAGGATTCAACGCCTTTTGGTAT
TCACATCACTTATTTGTTATTGTCTACGCCCTCTTCATCATCCACGGATACTATCTTTACCTCTCCAAGAAATGGTACAAGAAAACG
ACATGGATGTATCTTGCTGTCCCAATTCTATTA
TACACATGTGAACGTTTGACCCGTGCTTTTCGATCAGGTTATAAAACCGTACGAATATTAAAG
GTTGCAGTGTACCCTGGAAATGTACTAGCACTGCATATGTCAAAACCACAAGGATTT
CGATACACCAGTGGGCAATATGTGTTTGTAAATTGTTCTGCTGTTTCTACATTTCAATG
GCATCCATTTTCAATCACTTCTGCTCCTGGAGATGATTATTTGAGCATCCATATTCGAACC
TTAGGTGACTGGACATCGCAACTCAAAGCTGTTTTTTCTAAG
GTGTGTCAGCCGGCATCAATACACCAAAGTGGCCTTCTAAGAGCCGATATGGCACAACGCGATAATCAACCTAGGTTG
CCAAGGCTGCTAATTGATGGACCTTATGGGGCACCAGCACAGGACTACAAGAAATACGATGTTCTCCTTCTTGTTGGACTTGGCATTGGTGCCACCCCTCTAATAAGCATAGTCAAAGAT
GTGCTTAACAACATCAAGCAGCAAAAGGAAATGGAAGAGGGGTTAGTAGAAAGTGGTATCAAGGGCAACTACAGAAAGCCTTTCGCAACCAAACGAGCTTACTTCTATTGGGTCACTCGC
GAGCAGGGCTCGTTCGAGTGGTTTAGAGGTGTAATGAACGAGGTAGCTGATTATGATCAAGATAGAGTCATCGAACTTCATAATTACTGCACAAGTGTTTACGAAGAAGGCGATGCTCGA
TCAGCTTTAATCACCATGCTTCAATCTCTTCAACATGCTAAAAGTGGCGTCGATATAGTCTCCGAAACACGAGTTAAGACACATTTTGCCAGGCCTAATTGGCGAAAAGTGTTCAAGCAT
GTAGCTGTCAATTATCCTGATCAAAGAGTTG
GAGTGTTTTACTGTGGAGCACCTGGATTGACTGGAGAACTAAGAAGATTAGCTCAAGATTTCTCCAGGAAAACTACAACCAAATTCGAT
TTCCATAAAGAGAATTTCTAA

Retrieve as FASTA