Entry information : PtRboh08 (POPTR_0016s11970 / Potri.016G112200)
Entry ID 6076
Creation 2008-01-28 (Christophe Dunand)
Last sequence changes 2008-01-28 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-11 (Christophe Dunand)
Peroxidase information: PtRboh08 (POPTR_0016s11970 / Potri.016G112200)
Name (synonym) PtRboh08 (POPTR_0016s11970 / Potri.016G112200)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh002]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtRboh08
start..stop
S start..stop
PtRboh05 1519 0 1..852 1..846
EgrRboh06 1190 0 6..852 3..857
EglRboh06 1187 0 6..852 3..857
EguRboh06 1185 0 6..852 3..857
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11496342..11496735 394 N° 2 11496832..11496994 163 N° 3 11497065..11497113 49 N° 4 11497226..11497339 114
N° 5 11497421..11498230 810 N° 6 11498400..11498495 96 N° 7 11498573..11498688 116 N° 8 11498770..11498872 103
N° 9 11498959..11499059 101 N° 10 11499144..11499309 166 N° 11 11499406..11499534 129 N° 12 11499641..11499769 129
N° 13 11499863..11499941 79 N° 14 11500060..11500169 110  
join(11496342..11496735,11496832..11496994,11497065..11497113,11497226..11497339 ,11497421..11498230,11498400..11498495,11498573..11498688,11498770..11498872,114 98959..11499059,11499144..11499309,11499406..11499534,11499641..11499769,1149986 3..11499941,11500060..11500169)


exon

Literature and cross-references PtRboh08 (POPTR_0016s11970 / Potri.016G112200)
DNA ref. Phytozome 12:   Chr16 (11496342..11500169)
Cluster/Prediction ref. Genebank:   7487456
Omic ref. ePlant:   Potri.016G112200
Protein sequence: PtRboh08 (POPTR_0016s11970 / Potri.016G112200)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   0
PWM (Da):   %s   Transmb domain:   %s   o299-317i384-406o430-452i480-502o512-529i671-688o
PI (pH):   %s   6.11
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGSKTESKRWMLESIEIDRMRGVPVNDEPKATLPPKEPADAFIKRSASNLGASLRRTTSSALRKSGVLSSKPPLPKIERTASSASRGLKSLRFLDRTMTGKEMDAWRSIERRFDQFAVHERLPKDKFGICIGLGDSKEFAGEIFHAIARRKNICPANGITKDELKLFWEDMTKQDLDSRLGIFFDMCDKNGDGRLSELEVRVIELSASANKLTNLKQHAAVYAALIMEELDPDHLGYIGLWELETLLRGMVNNEDQTTKLDEKTHNLTNAMIPRRYRTPVTKFLTVSVEYIHENWRRIWVIALWLAVNFVLIFWKFKEFEKSPLFKISSYCVCLAKASAESLKFNMALILLPVCRRTLTKLRSSFLGTFIPFDDNISFHKTIALAIVIGTLAHTLAHVLCNIPLLSSCPEGKFMLFAGPLFHYQQPTYWFFMRSIVGVTGILMILIMGFSFTLATHHFRKNVVKLPGVFHRLAGFNAFWYAHHLLALAYLLCILHGYFLIFEKPWYAKTTWMYLIGPVLFYATERVFTKNQERFHRVDVIKAIIYTGNVLALYMGKPPGFKYESGMYLFIKCPDLSKFEWHPFSITSAPGDNNLSVHIRTVGDWTTELKNLFAVCEPPRDTKQNQGRLKRMETKALSNSNFDQIQATFPKILIKGPFGAPAQNYKKFDILLLIGLGIGATPFISILKDLLNQIKSNAAESRDQRMGSTDKKGPERAYFYWVTREQSSFDWFKGVMDDIADYDDNNIIEMHNYLTSVYEEGDARSALIAMVQKLQHAKNGLDVVSQSRIRTHFSRPNWRKVFTQMAETHKFSRIGVFYCGSALLVKPLRELCQEFTLNSSTRFQFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 16, 13 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAGCAAAACGGAATCAAAAAGGTGGATGCTTGAGAGCATTGAAATTGATAGGATGCGGGGTGTTCCTGTTAATGATGAACCTAAAGCCACCTTACCGCCCAAAGAACCTGCTGAT
GCATTCATCAAGAGGAGTGCAAGTAATCTTGGGGCATCCCTCAGAAGGACTACAAGTAGTGCCTTGAGGAAGAGTGGGGTTCTCTCTTCGAAACCTCCTCTCCCCAAGATAGAAAGAACA
GCATCATCAGCTTCTAGAGGACTTAAAAGCCTAAGGTTTCTTGATAGAACAATGACAGGAAAGGAAATGGATGCATGGAGATCCATCGAAAGGCGTTTTGATCAATTTGCAGTTCATGAA
AGGCTCCCTAAGGACAAATTTGGAATCTGCATTG
GTATGCTTTCGAAATCTTTCGTTGTTGACAGCATGCTTTTTCTCCTATCTTTTCAATATAAAAAACACAAATTGAACTTCATTCCC
TTTTTTGCAGGACTAGGAGATTCAAAAGAGTTTGCAGGAGAAATATTTCATGCAATTGCCAGGCGTAAGAATATATGCCCCGCAAATGGGATAACAAAAGATGAGTTGAAATTGTTTTGG
GAAGACATGACTAAACAAGATCTTGATTCTCGTCTTGGAATATTTTTTGATAT
GTAAGAAATCCCCCTTGTGAAGTCTAAACTGTTAAAGGGTTAACTTTAAGCTGACATAATGATTTAA
TAGGTGCGACAAGAATGGGGATGGGAGGCTTTCGGAGTTGGAAGTGAGGGAGGTGTGGCTATATTGCCCTTCTGCATAATTGTTATTTTCCTTTTCTTTTGTTTTTTTTTTCTTCCTCTT
CACATCACGATATTTCAATTTTCTGATTTTATGTTTTGCCAAAGGTTATAGAGTTGAGTGCCTCTGCAAACAAGCTCACAAATCTTAAACAGCATGCGGCAGTCTATGCAGCTCTAATCA
TGGAAGAACTTGATCCTGATCATCTTGGATATATAGGG
GTTGGTATTTATGCAAAAACTCTGGTTTCAAATTTTGTGACTGTGTGGCAATTAGAAACCCTACTTTTTCTAGTTTTGCAGC
TATGGGAGCTTGAAACTCTGCTAAGAGGGATGGTGAATAATGAAGATCAAACGACGAAGCTCGATGAAAAAACGCATAATCTCACAAATGCCATGATCCCAAGAAGATATAGGACTCCTG
TTACCAAATTCTTGACTGTGTCAGTAGAATATATTCATGAGAACTGGAGGAGAATATGGGTTATCGCGTTGTGGTTAGCTGTAAACTTCGTACTCATTTTTTGGAAGTTTAAGGAGTTCG
AGAAATCACCGCTATTCAAAATCTCAAGTTATTGTGTCTGTCTTGCCAAGGCTTCTGCCGAGAGTCTCAAGTTTAATATGGCCCTCATTCTTCTTCCTGTCTGCAGAAGAACACTTACTA
AGCTTAGATCATCATTTCTCGGCACCTTTATCCCTTTCGATGACAACATAAGCTTTCACAAGACGATTGCTTTGGCCATAGTAATTGGGACTCTAGCTCATACTCTAGCACATGTGCTTT
GTAATATTCCGTTGTTGAGTTCATGCCCAGAAGGCAAATTCATGCTATTTGCTGGACCATTGTTCCATTACCAACAGCCAACTTATTGGTTCTTCATGCGAAGCATTGTAGGCGTAACCG
GAATTCTGATGATCCTTATAATGGGGTTCTCATTTACTTTGGCGACACACCATTTCCGAAAGAACGTCGTTAAGTTACCAGGGGTATTTCACAGATTGGCAGGGTTTAATGCCTTTTGGT
ATGCGCATCATCTGCTCGCCCTAGCATATCTACTGTGCATTTTGCATGGCTACTTCTTAATATTTGAAAAGCCTTGGTATGCCAAAACG
GTATGCACAGCCCTCAGCTAGCTACTTCTTC
ATTAAGCATAACCTTTTTCTTCCATTTGTGCTTCAACAATTCTGAATGCAATATTTTCATGACAAAAAAATTTCTCTTCTGAACATATATAGGTTAAAGCGGTTGCTGAAACTAATTGTG
TTATCTAACTTTCCACAGACATGGATGTATCTCATTGGCCCAGTATTGTTCTATGCCACTGAGAGAGTCTTCACAAAAAATCAGGAACGCTTTCACCGTGTTGATGTCATTAAGGTCTGT
GTTATTGATGTTTATTGTCCTCATCCATGATATTAATTCATAAAACTCATCGTGTACTTTGGACATTACAGGCAATTATATATACAGGGAATGTTCTTGCTCTATACATGGGCAAGCCTC
CAGGATTTAAGTACGAAAGTGGAATGTACCTCTTTATCAAATGCCCGGATTTGTCCAAGTTTGAATG
GTAATCAATTGATCTCCGATAGTGTTTTCTGTTCCATAATACATCTCTTTAGT
AAAAAAATTCAGTTCTTATTTCATATAGGCATCCCTTCTCCATCACTTCTGCACCAGGAGATAACAATTTGAGTGTCCACATAAGAACTGTGGGTGATTGGACTACAGAACTCAAAAACT
TATTTGCGAAG
GTTATGGCTTGATTGGTGTCTCTCTATATCCATGCAACTGAGGCAGATTTAGTGACATGTTATTTGCAAATGTTATATTTTCGCAGGTCTGTGAGCCCCCCCGGGATAC
TAAACAAAACCAAGGAAGGCTAAAGAGAATGGAAACTAAAGCATTGTCAAACTCAAACTTCGATCAGATACAAGCAAC
GTCAGTAAATTAATTCTTAAATAATCTATACTTGAGATTTTG
TGAAAACTAAAACTAAAATAGCCCCCTTTTCACCTGAGGCAGATTTCCAAAGATCCTGATCAAAGGACCATTTGGAGCCCCCGCTCAGAATTACAAAAAGTTTGACATATTACTGCTCAT
AGGTCTAGGAATTGGAGCAACTCCATTTATCAGCATTTTGAAGGATCTGCTCAATCAGATCAAATCAAATGCAGCGGAGTCGAGGAGG
GTACGTTACGTATAGTGCAAAGCACACATCAC
TGCCATAAGATTGCTTAGACAAATAAGTTGAAAATCAATTCAGCTAACATATGATTGCACGCAGGACCAACGAATGGGTTCAACTGATAAAAAGGGTCCAGAAAGAGCATACTTTTACTG
GGTCACAAGAGAACAAAGTTCTTTTGATTGGTTCAAGGGTGTCATGGACGATATTGCAGACTATGATGATAAT
GTGGGTTTTGATAGCTGAAAAATGTCCTCATTTTACAAATTCTCAGC
CCGTCAAGGGTTTCTAATCTAACCAGTAATTATTCCTTTGGAACTTTTCAATGTCTCAGAATATAATTGAAATGCACAACTACTTGACTAGTGTGTATGAAGAAGGAGATGCAAGGTCTG
CACTTATTGCCATGGTACAAAAACTGCAGCATGCAAAGAATGGACTTGATGTTGTCTCCCAAAGTCGG
GTATTGATCAGCTTGACTGACCACTGCATCATTAACGATATACTATGTTTTT
TTCTTTTAAATTCCTTGCTAATATGTAATAGAATGTGACAGATAAGAACGCATTTTTCAAGACCCAACTGGAGAAAGGTATTTACTCAAATGGCAGAAACACATAAATTTTCTCGGATAG
GTAAGTGTGGAACTGTAAAGAACCTTTTTTGGTACCATGGCGCACCATATCTTTTTCAGCTATATCATTAGTTTTATGCTTAGGTCCTTTGTTTACTTCTTGATGTCTTGGTTTGCAGGC
GTCTTCTACTGTGGAAGTGCTCTCCTTGTCAAACCACTGAGGGAGCTTTGCCAAGAATTTACTCTAAATTCATCAACTCGTTTCCAATTTCATAAGGAGAACTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAGCAAAACGGAATCAAAAAGGTGGATGCTTGAGAGCATTGAAATTGATAGGATGCGGGGTGTTCCTGTTAATGATGAACCTAAAGCCACCTTACCGCCCAAAGAACCTGCTGAT
GCATTCATCAAGAGGAGTGCAAGTAATCTTGGGGCATCCCTCAGAAGGACTACAAGTAGTGCCTTGAGGAAGAGTGGGGTTCTCTCTTCGAAACCTCCTCTCCCCAAGATAGAAAGAACA
GCATCATCAGCTTCTAGAGGACTTAAAAGCCTAAGGTTTCTTGATAGAACAATGACAGGAAAGGAAATGGATGCATGGAGATCCATCGAAAGGCGTTTTGATCAATTTGCAGTTCATGAA
AGGCTCCCTAAGGACAAATTTGGAATCTGCATTG
GACTAGGAGATTCAAAAGAGTTTGCAGGAGAAATATTTCATGCAATTGCCAGGCGTAAGAATATATGCCCCGCAAATGGGATAACA
AAAGATGAGTTGAAATTGTTTTGGGAAGACATGACTAAACAAGATCTTGATTCTCGTCTTGGAATATTTTTTGATAT
GTGCGACAAGAATGGGGATGGGAGGCTTTCGGAGTTGGAAGTG
AGGGAG
GTTATAGAGTTGAGTGCCTCTGCAAACAAGCTCACAAATCTTAAACAGCATGCGGCAGTCTATGCAGCTCTAATCATGGAAGAACTTGATCCTGATCATCTTGGATATATAGGG
CTATGGGAGCTTGAAACTCTGCTAAGAGGGATGGTGAATAATGAAGATCAAACGACGAAGCTCGATGAAAAAACGCATAATCTCACAAATGCCATGATCCCAAGAAGATATAGGACTCCT
GTTACCAAATTCTTGACTGTGTCAGTAGAATATATTCATGAGAACTGGAGGAGAATATGGGTTATCGCGTTGTGGTTAGCTGTAAACTTCGTACTCATTTTTTGGAAGTTTAAGGAGTTC
GAGAAATCACCGCTATTCAAAATCTCAAGTTATTGTGTCTGTCTTGCCAAGGCTTCTGCCGAGAGTCTCAAGTTTAATATGGCCCTCATTCTTCTTCCTGTCTGCAGAAGAACACTTACT
AAGCTTAGATCATCATTTCTCGGCACCTTTATCCCTTTCGATGACAACATAAGCTTTCACAAGACGATTGCTTTGGCCATAGTAATTGGGACTCTAGCTCATACTCTAGCACATGTGCTT
TGTAATATTCCGTTGTTGAGTTCATGCCCAGAAGGCAAATTCATGCTATTTGCTGGACCATTGTTCCATTACCAACAGCCAACTTATTGGTTCTTCATGCGAAGCATTGTAGGCGTAACC
GGAATTCTGATGATCCTTATAATGGGGTTCTCATTTACTTTGGCGACACACCATTTCCGAAAGAACGTCGTTAAGTTACCAGGGGTATTTCACAGATTGGCAGGGTTTAATGCCTTTTGG
TATGCGCATCATCTGCTCGCCCTAGCATATCTACTGTGCATTTTGCATGGCTACTTCTTAATATTTGAAAAGCCTTGGTATGCCAAAACG
ACATGGATGTATCTCATTGGCCCAGTATTG
TTCTATGCCACTGAGAGAGTCTTCACAAAAAATCAGGAACGCTTTCACCGTGTTGATGTCATTAAG
GCAATTATATATACAGGGAATGTTCTTGCTCTATACATGGGCAAGCCTCCAGGA
TTTAAGTACGAAAGTGGAATGTACCTCTTTATCAAATGCCCGGATTTGTCCAAGTTTGAATG
GCATCCCTTCTCCATCACTTCTGCACCAGGAGATAACAATTTGAGTGTCCACATAAGA
ACTGTGGGTGATTGGACTACAGAACTCAAAAACTTATTTGCGAAG
GTCTGTGAGCCCCCCCGGGATACTAAACAAAACCAAGGAAGGCTAAAGAGAATGGAAACTAAAGCATTGTCAAAC
TCAAACTTCGATCAGATACAAGCAAC
ATTTCCAAAGATCCTGATCAAAGGACCATTTGGAGCCCCCGCTCAGAATTACAAAAAGTTTGACATATTACTGCTCATAGGTCTAGGAATTGGA
GCAACTCCATTTATCAGCATTTTGAAGGATCTGCTCAATCAGATCAAATCAAATGCAGCGGAGTCGAGGAGG
GACCAACGAATGGGTTCAACTGATAAAAAGGGTCCAGAAAGAGCATAC
TTTTACTGGGTCACAAGAGAACAAAGTTCTTTTGATTGGTTCAAGGGTGTCATGGACGATATTGCAGACTATGATGATAAT
AATATAATTGAAATGCACAACTACTTGACTAGTGTGTAT
GAAGAAGGAGATGCAAGGTCTGCACTTATTGCCATGGTACAAAAACTGCAGCATGCAAAGAATGGACTTGATGTTGTCTCCCAAAGTCGG
ATAAGAACGCATTTTTCAAGACCCAACTGG
AGAAAGGTATTTACTCAAATGGCAGAAACACATAAATTTTCTCGGATAG
GCGTCTTCTACTGTGGAAGTGCTCTCCTTGTCAAACCACTGAGGGAGCTTTGCCAAGAATTTACTCTAAAT
TCATCAACTCGTTTCCAATTTCATAAGGAGAACTTCTAA

Retrieve as FASTA