Entry information : PtRboh05 (POPTR_0006s09850 / Potri.006G097200)
Entry ID 6077
Creation 2008-01-28 (Christophe Dunand)
Last sequence changes 2008-01-28 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtRboh05 (POPTR_0006s09850 / Potri.006G097200)
Name (synonym) PtRboh05 (POPTR_0006s09850 / Potri.006G097200)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh002]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtRboh05
start..stop
S start..stop
PtRboh08 1494 0 1..846 1..852
EgrRboh06 1192 0 6..846 3..857
EglRboh06 1189 0 6..846 3..857
EguRboh06 1188 0 6..846 3..857
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7424185..7424578 394 N° 2 7424675..7424837 163 N° 3 7424912..7424960 49 N° 4 7425064..7425177 114
N° 5 7425259..7426071 813 N° 6 7426236..7426331 96 N° 7 7426427..7426542 116 N° 8 7426624..7426726 103
N° 9 7426828..7426928 101 N° 10 7427011..7427176 166 N° 11 7427271..7427378 108 N° 12 7427486..7427614 129
N° 13 7427715..7427793 79 N° 14 7427966..7428075 110  
join(7424185..7424578,7424675..7424837,7424912..7424960,7425064..7425177,7425259 ..7426071,7426236..7426331,7426427..7426542,7426624..7426726,7426828..7426928,74 27011..7427176,7427271..7427378,7427486..7427614,7427715..7427793,7427966..74280 75)


exon

Literature and cross-references PtRboh05 (POPTR_0006s09850 / Potri.006G097200)
DNA ref. Phytozome 12:   Chr06 (7424185..7428075)
Omic ref. ePlant:   Potri.006G097200
Protein sequence: PtRboh05 (POPTR_0006s09850 / Potri.006G097200)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   0
PWM (Da):   %s   Transmb domain:   %s   i299-316o384-406i431-453o481-503i672-689o
PI (pH):   %s   6.11
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGSRTESKKWMLENIEIDRMVEVPINDEPKKAFPPRGPVGASIKWSASNLGASLRRTTSSALRKNGVLSSKPPRPKMERTASSAARGLKSLRFLDRTVTGKEMDAWRSIERRFDQFAVDERLPKDKFGICIGLGDSKEFAGEIFDAIARRKNIFTANGITKDELKLFWEDMTKQDLDSRLGIFFDMCDKNGDGRLSEEEVKIIVLSASANKLTNLKQYAAVYAALIMEELDPDHLGYIGLWQLETLLREMVNNEDQITTKLNRSTHTLTRAMIPRRYRTPVTKSLSLSVEYIHENWRRIWVMTLWLAVNLALFIWKFKEFEKSPLFKISSYCVCLAKASAETLKLNMALILLPVCRRTLTKLRSSFLGTFIPFDDNINFHKNIALAIVIATVAHTLAHMLCNIPLLSSCPKDKFMAYAGPLFNYQQPTYWFFIRSSVGVTGILIILVMGFSFTLATHYFRKNVVKLPGAFHKLAGFNAFWYAHQLLALAYLLCFLHGYFLIFEKPWYAKTTWMYLIGPVVFYATERISTKYQEHHHQVDVIKAIIYTGNVLALYMNKPPGFKYESGMYLFIKSPDLSSFEWHPFSITSAPGDNNLSVHIRTVGDWTTELKNLFAVCEAPPAAKQKQGRLNRLETIAMSNSNYDQIQATFPKILIKGPFGAPAQNYKKFDILLLIGLGIGATPFISILKDLLNGIKPSAADSMDRRCTERAYFYWVTREQSSFDWFKGVMDDVADYDDNHIIEMHNYLTSVYEEGDARSALIAMVQKLQHAKNGLDVVSQSRIRTHFARPNWRKVFAQMAETHKSSRIGVFYCGSALLVKTLRELCQEFTLDSSTRFQFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo LGVI (CM000342), 13 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTAGCAGAACAGAATCAAAAAAGTGGATGCTCGAAAACATTGAAATTGATAGGATGGTGGAAGTTCCTATCAATGATGAACCAAAAAAAGCCTTTCCACCCAGAGGACCTGTTGGC
GCATCTATCAAGTGGAGTGCAAGTAATCTTGGGGCATCCCTCAGAAGGACTACAAGCAGTGCCTTGAGGAAGAATGGTGTTCTCTCTTCGAAACCTCCTCGCCCCAAGATGGAAAGGACA
GCATCATCTGCTGCAAGAGGGCTTAAAAGCCTAAGGTTTCTTGATAGAACAGTGACAGGAAAGGAAATGGATGCATGGAGATCAATCGAAAGGCGCTTTGATCAATTTGCAGTTGATGAA
AGGCTCCCAAAGGACAAATTTGGAATCTGCATTG
GTATGCTGTTGAAATCTTTCGTTGTTGAGCGTGTGCGCATTATCCTGTTTTTCAAAAATAACGAACACAAATGGATACTTGATTCC
TTTTTTGCAGGACTAGGAGATTCAAAAGAGTTTGCTGGAGAAATATTTGACGCAATTGCTAGGCGTAAGAATATATTCACCGCAAATGGGATCACAAAAGATGAGTTGAAATTGTTTTGG
GAAGACATGACTAAACAAGATCTTGATTCTCGACTTGGAATATTTTTTGATAT
GTAAGAAATCCCCCCCTTGAAGTCTAGACAGCTAAAATATGGTGCAACATTAAGCTGACATAATGAT
GTCCTAGGTGCGACAAGAATGGCGATGGGAGGCTATCGGAGGAGGAAGTGAAGGAGGTGTGTATGGTTATATTGTCCTCGTGCACAATTATTCTTTTTTTATTATTATTCTTCCTCCTGA
TCATGATATTTCGATTTCCTGGTTTACGTTATGCTAAAGATTATAGTGTTAAGTGCCTCCGCAAACAAGCTCACAAATCTTAAACAGTACGCGGCAGTCTATGCAGCTCTAATCATGGAA
GAGCTTGATCCTGATCATCTTGGATATATAGGG
GTTAGTATTTATGCAAAAACTCTGGTTTCAAATTCTGAGACAATGTGGCAATTAGAAACTCTATTTGTTCTAGTTTTGCAGCTATGG
CAGCTAGAAACTCTACTAAGAGAGATGGTGAATAATGAAGATCAAATTACCACGAAGCTCAATAGAAGCACACATACTCTCACAAGAGCCATGATCCCAAGAAGATATCGGACTCCTGTT
ACCAAATCATTGTCGCTGTCAGTAGAATATATTCATGAGAATTGGAGGAGAATATGGGTTATGACGTTATGGTTAGCTGTAAACTTGGCACTTTTTATTTGGAAGTTTAAGGAATTCGAG
AAATCACCCCTATTCAAAATCTCAAGTTATTGTGTCTGTCTTGCCAAGGCTTCCGCGGAGACTCTCAAGTTGAATATGGCTCTCATTCTTCTTCCTGTTTGCAGAAGAACACTCACTAAG
CTTAGATCGTCATTTCTCGGCACCTTTATCCCTTTTGATGACAACATAAACTTTCACAAAAACATTGCTTTGGCCATAGTAATTGCGACTGTAGCTCATACTCTAGCACATATGCTTTGT
AATATTCCGTTGTTGAGTTCATGCCCAAAAGACAAATTCATGGCATATGCTGGACCATTGTTCAATTACCAACAGCCAACTTATTGGTTCTTCATACGAAGTAGTGTAGGCGTCACCGGA
ATTCTGATTATCCTTGTAATGGGGTTCTCATTTACATTGGCAACACACTATTTCCGAAAGAATGTCGTTAAGTTACCAGGGGCGTTTCACAAATTGGCAGGGTTTAATGCTTTCTGGTAT
GCGCATCAGTTGCTGGCCTTGGCATACCTGCTATGTTTTTTGCATGGCTACTTCTTAATCTTTGAAAAACCTTGGTATGCCAAAACG
GTATGTGCAATCCTCAGCTAGCTACTTGTTCAT
TAAGCATAACTTTCTCTGCCATTTGTGCTCCAACTGTTCTGAATGCAATATTTTCGTGACAACAAAATTTCTCTTCTGAACATGGGTTAATGAGGTTGCTGAAACTAATTGTGTAATCTA
ACTTTTCACAGACATGGATGTATCTCATTGGCCCAGTAGTATTCTACGCCACAGAGAGAATCTCTACAAAATATCAGGAACACCATCACCAGGTTGATGTCATTAAGGTCTGTATTAGTG
AGATTTCTTCTCCTCAAATCACTTGCTTTCCTGATCCCTGATATTAATTCATTAAACTCATCATGTACTTTGGGAATTACAGGCAATTATATATACAGGGAATGTTCTTGCTCTATACAT
GAACAAGCCTCCAGGATTTAAGTACGAAAGTGGAATGTACCTCTTCATCAAGAGCCCGGATTTGTCAAGTTTTGAATG
GTAATAAACTGATCTCCAGTACTTCATTAGAATGCTTTCCAT
GCCATTTAATAAAAAAATCCCAGTTCTTATTGCTTACAGGCATCCCTTCTCCATCACTTCTGCACCAGGAGATAACAATTTGAGTGTCCACATACGAACCGTGGGTGATTGGACTACGGA
ACTCAAAAACTTATTTGCAAAG
GTTATGGCTTAATTGGTGTTTCACCATATCCATGCAAATGAAGCTGTTTTATTGAGATGAGAAATACAAATTATATACTTAAAGAATGTTATATTTCG
CAGGTCTGTGAGGCCCCACCTGCTGCGAAACAAAAACAAGGCAGGCTAAATAGATTGGAAACAATAGCAATGTCAAACTCGAATTATGATCAGATACAAGCAACGTGAGTAAATTAAGTC
TTAACTGATCTCTTCGACAGTTTTTTAAAACTAGAAATATAATAGCCCCTTTTTTTCTTATGGCAGATTCCCAAAGATCCTGATCAAAGGACCTTTCGGAGCCCCAGCTCAGAATTACAA
GAAGTTCGACATCCTATTGCTCATAGGTCTAGGAATCGGAGCAACTCCCTTTATCAGCATTTTGAAGGATCTCCTTAATGGCATCAAACCAAGTGCAGCCGATTCGATGAAG
GTAGGTTA
TGCAGAACCAAACAAATATCTGTTCCATAAGATTGCTTAGACTAATAAGTTGAAAATCATTTCGGCTAACACATGATTGCACTCAGGACCGACGATGTACAGAAAGAGCATACTTTTACT
GGGTCACAAGAGAACAAAGCTCTTTTGATTGGTTTAAGGGTGTCATGGACGATGTTGCAGACTATGATGATAAT
GTATAGGTTTTGATAGCTGAAAAAGTCATCCTTTTACATACTTTTC
ACCCTCATCGCTGATGCTCTAATCTAACCAGTAATTTTATTGACACTTTTGAATATATCAGCATATAATAGAAATGCACAACTACTTGACTAGTGTGTATGAAGAAGGAGATGCAAGGTC
TGCACTTATTGCCATGGTACAAAAACTGCAGCATGCAAAGAATGGACTTGATGTTGTCTCCCAAAGCCGG
GTACAAATCAGTTTGACAGGCCACTGCATCATCGACTATATACTAATATA
CTATGTTTACTTTTGAATCTTTTTTCCTAACATGCAATAGAATGTGACAGATAAGAACGCATTTTGCAAGGCCCAACTGGAGAAAGGTGTTCGCTCAAATGGCAGAAACGCACAAGTCTT
CTCGGATAG
GTGAGGATACAGCTATAATGAATTTTCATGTTCGTAAGTTATGAGATTGTTTTTTTATTCGAAAATAATAGATGGCTTCGAGTGATCAGCTTCCACATCAACCAAAATTGT
AATTAAGCTCCGTTTTATACTTAGATATCCTTTATATATTTCTTTATGTTTCGGTTTGCAGGTGTCTTCTACTGTGGAAGCGCTCTGCTTGTCAAAACACTGAGAGAGCTTTGCCAAGAA
TTTACTCTAGATTCATCAACCCGTTTCCAATTTCATAAGGAGAACTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTAGCAGAACAGAATCAAAAAAGTGGATGCTCGAAAACATTGAAATTGATAGGATGGTGGAAGTTCCTATCAATGATGAACCAAAAAAAGCCTTTCCACCCAGAGGACCTGTTGGC
GCATCTATCAAGTGGAGTGCAAGTAATCTTGGGGCATCCCTCAGAAGGACTACAAGCAGTGCCTTGAGGAAGAATGGTGTTCTCTCTTCGAAACCTCCTCGCCCCAAGATGGAAAGGACA
GCATCATCTGCTGCAAGAGGGCTTAAAAGCCTAAGGTTTCTTGATAGAACAGTGACAGGAAAGGAAATGGATGCATGGAGATCAATCGAAAGGCGCTTTGATCAATTTGCAGTTGATGAA
AGGCTCCCAAAGGACAAATTTGGAATCTGCATTG
GACTAGGAGATTCAAAAGAGTTTGCTGGAGAAATATTTGACGCAATTGCTAGGCGTAAGAATATATTCACCGCAAATGGGATCACA
AAAGATGAGTTGAAATTGTTTTGGGAAGACATGACTAAACAAGATCTTGATTCTCGACTTGGAATATTTTTTGATAT
GTGCGACAAGAATGGCGATGGGAGGCTATCGGAGGAGGAAGTG
AAGGAG
ATTATAGTGTTAAGTGCCTCCGCAAACAAGCTCACAAATCTTAAACAGTACGCGGCAGTCTATGCAGCTCTAATCATGGAAGAGCTTGATCCTGATCATCTTGGATATATAGGG
CTATGGCAGCTAGAAACTCTACTAAGAGAGATGGTGAATAATGAAGATCAAATTACCACGAAGCTCAATAGAAGCACACATACTCTCACAAGAGCCATGATCCCAAGAAGATATCGGACT
CCTGTTACCAAATCATTGTCGCTGTCAGTAGAATATATTCATGAGAATTGGAGGAGAATATGGGTTATGACGTTATGGTTAGCTGTAAACTTGGCACTTTTTATTTGGAAGTTTAAGGAA
TTCGAGAAATCACCCCTATTCAAAATCTCAAGTTATTGTGTCTGTCTTGCCAAGGCTTCCGCGGAGACTCTCAAGTTGAATATGGCTCTCATTCTTCTTCCTGTTTGCAGAAGAACACTC
ACTAAGCTTAGATCGTCATTTCTCGGCACCTTTATCCCTTTTGATGACAACATAAACTTTCACAAAAACATTGCTTTGGCCATAGTAATTGCGACTGTAGCTCATACTCTAGCACATATG
CTTTGTAATATTCCGTTGTTGAGTTCATGCCCAAAAGACAAATTCATGGCATATGCTGGACCATTGTTCAATTACCAACAGCCAACTTATTGGTTCTTCATACGAAGTAGTGTAGGCGTC
ACCGGAATTCTGATTATCCTTGTAATGGGGTTCTCATTTACATTGGCAACACACTATTTCCGAAAGAATGTCGTTAAGTTACCAGGGGCGTTTCACAAATTGGCAGGGTTTAATGCTTTC
TGGTATGCGCATCAGTTGCTGGCCTTGGCATACCTGCTATGTTTTTTGCATGGCTACTTCTTAATCTTTGAAAAACCTTGGTATGCCAAAACG
ACATGGATGTATCTCATTGGCCCAGTA
GTATTCTACGCCACAGAGAGAATCTCTACAAAATATCAGGAACACCATCACCAGGTTGATGTCATTAAG
GCAATTATATATACAGGGAATGTTCTTGCTCTATACATGAACAAGCCTCCA
GGATTTAAGTACGAAAGTGGAATGTACCTCTTCATCAAGAGCCCGGATTTGTCAAGTTTTGAATG
GCATCCCTTCTCCATCACTTCTGCACCAGGAGATAACAATTTGAGTGTCCACATA
CGAACCGTGGGTGATTGGACTACGGAACTCAAAAACTTATTTGCAAAG
GTCTGTGAGGCCCCACCTGCTGCGAAACAAAAACAAGGCAGGCTAAATAGATTGGAAACAATAGCAATGTCA
AACTCGAATTATGATCAGATACAAGCAAC
ATTCCCAAAGATCCTGATCAAAGGACCTTTCGGAGCCCCAGCTCAGAATTACAAGAAGTTCGACATCCTATTGCTCATAGGTCTAGGAATC
GGAGCAACTCCCTTTATCAGCATTTTGAAGGATCTCCTTAATGGCATCAAACCAAGTGCAGCCGATTCGATGAAG
GACCGACGATGTACAGAAAGAGCATACTTTTACTGGGTCACAAGA
GAACAAAGCTCTTTTGATTGGTTTAAGGGTGTCATGGACGATGTTGCAGACTATGATGATAAT
CATATAATAGAAATGCACAACTACTTGACTAGTGTGTATGAAGAAGGAGATGCAAGG
TCTGCACTTATTGCCATGGTACAAAAACTGCAGCATGCAAAGAATGGACTTGATGTTGTCTCCCAAAGCCGG
ATAAGAACGCATTTTGCAAGGCCCAACTGGAGAAAGGTGTTCGCTCAA
ATGGCAGAAACGCACAAGTCTTCTCGGATAG
GTGTCTTCTACTGTGGAAGCGCTCTGCTTGTCAAAACACTGAGAGAGCTTTGCCAAGAATTTACTCTAGATTCATCAACCCGTTTCCAA
TTTCATAAGGAGAACTTCTGA

Retrieve as FASTA