Entry information : PtRboh02 (POPTR_0001s09970)
Entry ID 6078
Creation 2008-01-28 (Christophe Dunand)
Last sequence changes 2010-07-12 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtRboh02 (POPTR_0001s09970)
Name (synonym) PtRboh02 (POPTR_0001s09970)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtRboh02
start..stop
S start..stop
PtRboh03 1843 0 1..949 1..948
CsRboh01 1651 0 1..949 1..946
CclRboh01 1650 0 1..949 1..946
GmRboh12 1593 0 5..949 4..941
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7710950..7711610 661 N° 2 7711828..7711987 160 N° 3 7712387..7712435 49 N° 4 7713089..7713202 114
N° 5 7714515..7714937 423 N° 6 7716391..7716777 387 N° 7 7716859..7716954 96 N° 8 7717112..7717227 116
N° 9 7717585..7717752 168 N° 10 7717865..7718024 160 N° 11 7718189..7718386 198 N° 12 7718488..7718616 129
N° 13 7718809..7718887 79 N° 14 7718973..7719082 110  
join(7710950..7711610,7711828..7711987,7712387..7712435,7713089..7713202,7714515 ..7714937,7716391..7716777,7716859..7716954,7717112..7717227,7717585..7717752,77 17865..7718024,7718189..7718386,7718488..7718616,7718809..7718887,7718973..77190 82)


exon

Literature and cross-references PtRboh02 (POPTR_0001s09970)
DNA ref. Phytozome 11:   scaffold_1 (7710950..7719082)
Cluster/Prediction ref. UniGene:   Pth.12536 [3' end]
Protein sequence: PtRboh02 (POPTR_0001s09970)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   237
PWM (Da):   %s   25997.4 Transmb domain:   %s   o387-406i526-548o568-590i747-764o
PI (pH):   %s   8.41
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRASLPKHERRWASDTLPGNATMSTGTSPGTESGEEFVEVTLDLQGDDTIVLRSVEPATSTVINIDDVSFTTGGSVSAGAVTPVSRSPTIRRSSSNKLLQFSQELKAEAVAKARQFSHELKAELRRFSWSHGQAARILSASGNNGGGAFESALAARALRKQRAQLDRTRSGAHKALRGLRFISKNSKKTNGVDAWSEVQSNFEKLAEDGYLNRADFAQCIGMKDSKEFALELFDALGRRRRLKADKICGDELYEFWSQITDQSFDSRLQIFFDMVDKNEDGRITEEEVKIIMLSASANKLSRLKEQAEEYAALIMEELDPERFGYIELWQLETLLLQKDTYLNYSQALSYTSQALSQNLQGLRKRSPIRRVSKQCVYFFQENWRRIWVLTLWVMIMIGLFAWKFFQYKQKNAFQVMGYCLLTAKGAAETLKFNMALILLPVCRNTITWLRSTRLGPLVPFDDNINFHKTIAAAIVIGVILHAGNHLVCDFPRLINSSDEQYRAYLSDDFGGNKPSYAKLARGTEGVTGILMVISMAIAFTLATRWFRRSLIKFPKPFDRLTGYNAFWYSHHLFVIVYILLTIHGVFLYMVHKWYKKTTWMYLSVPVLLYAGERALRFFRSGFYTVRLLKVAIYPGNVLTLQMSKPPQFRYKSGQYMFVQCPAVSLFEWHPFSITSAPGDDYLSVHIRQLGDWTQELRRVFSEACERPVAGKSGLLRADETTKKSLPKLLIDAPYGAPAQDYRKYDVLLLVGLGIGATPFISILKDLLNNIVKMEEQDSVLDISRTSDLSIGSNDTSTSNKVSPKRKKAVRTTNAYFYWVTREQSSFDWFKGVMNEVAELDQRGVIEMHNYLTSVYEEGDARSTLITMVQALNHAKNGVDIVSGTRVRTHFARPNWKKVLSKLCSKHCNARIGVFYCGAPVLAKELGKLCYDFNQKGSTKFEFHKEHF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 13 introns) and 3 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAGCTTCATTGCCTAAACACGAGCGGAGATGGGCCTCGGACACGCTTCCCGGCAATGCAACGATGAGCACCGGAACATCGCCGGGAACTGAGTCCGGCGAGGAGTTTGTTGAGGTG
ACACTTGATTTACAAGGTGATGACACGATTGTGCTTCGTAGTGTTGAGCCAGCAACATCAACGGTTATCAACATCGATGATGTTTCTTTCACTACTGGTGGTTCTGTGTCTGCCGGAGCT
GTAACTCCGGTGTCGAGATCGCCGACGATCAGGCGGAGTTCGTCGAATAAGTTGTTGCAATTTTCTCAGGAGTTGAAAGCTGAAGCTGTAGCGAAAGCTAGGCAATTTTCGCATGAGTTG
AAAGCTGAGTTAAGGAGGTTTTCTTGGAGTCATGGACAGGCAGCTCGGATTTTATCAGCCTCGGGAAATAATGGCGGTGGTGCTTTTGAGTCAGCTTTAGCCGCCCGTGCTTTGAGAAAG
CAGCGAGCGCAGCTGGACCGGACTCGGTCTGGTGCTCACAAAGCCTTGCGTGGATTGAGATTTATAAGTAAGAACAGTAAAAAAACTAATGGCGTTGATGCATGGAGTGAAGTTCAAAGC
AATTTTGAAAAACTTGCTGAAGATGGTTATCTTAACCGGGCCGATTTTGCACAATGCATAG
GTTCGATTCTCTTTTGACTTTCTATTTTCTTTCTCTTGGTTTTAGCGAAAGCAGCTAGC
TAGCTTTCAAAGCACGAACCGAGTCTAAATTATTGATTTTTTTTCTACTTGGATTTCAATATTTATGGATAAAAAAGGCAACAAAAGTACTGAAGATTTAGTTGTCATGTTCGTATGAAG
TCTTGGAAATTGATTTTTTAGATTTTTGTTTTGACAAGGAATGAAAGATTCGAAGGAGTTTGCTTTGGAGCTTTTTGATGCATTGGGAAGGAGAAGAAGATTGAAAGCGGACAAGATTTG
TGGAGATGAGCTTTACGAGTTTTGGTCACAAATTACCGATCAAAGCTTTGATTCTCGACTCCAGATCTTCTTCGATAT
GTACGCCTTATTACGGACTAGTGTATAATATAATTAAACTTA
ATTGGTGACTTATTTTGTTCATTAATTAATTCACCTCTTTCCTTTTCTTAAAAAGAAAAAACAAATATTGTATGTTAAATATCTCACTCTTATCTGAGATCATGCAAGCAAAGATATGGA
ACCAACATGGTTTTGGTCCATCGGAACCCAGTTTGTGTCTTTTCCGAACTCTGTACTAGAAATGAAAAAAAAAAAAAAGAGAAGAGAGAGGATAAAACTGTATTTTCCTCCGAACCCCAA
TTATTGAAAAAGTGATTAAACAATATTTTCTGCCATTTTTCTCTTCTCACTATCAAGTAATCTTGAATTAGCGGATAAACTAGGTGATAAACTACTTTTCTGTTGTTATGTTTGCAGGGT
GGACAAGAACGAAGACGGTAGAATCACTGAAGAAGAAGTCAAAGAG
GTACTACAAATGAATTTAAGAAGACATTATAATTAATCATGTCTTTCTCTCTAATTCAATTAATTTAATCTTAA
CTAGTTACATTGATTAAGTGCTTAATCTTAAAGTAACGTGCATGAATTAGCCAACAGCCTGTCAAATTATTGTAGAAATAAAATAAGAACCGACCTTCCAAATATGAGGTAGAATAATTA
AATTAAATAAAAAACAGATGACCCTTTATATCATGAATATTGCCGAAGCTCTTTAGTTATAAAATAAGATAGCAGGCTATATCAATAAACAGGGTGTCATTTTTTCTATTAAGATAATCG
CTGAAGAAGGAGAGGATTCGGTGACCCTAAATTTATGAAAATTCTAAAACTAACCAACCCAATAGAATAGACATGATTCAATTTTTTCTTGATCTCTGACGCCATTCCCACGTTCTCAAG
CATCTTATGAACTGGGTCTTTCTTTGAAGAGTTTCAGGTTGAGAGACGGCAACCTTCATCTATATATATATAGTACGATTTTCTCAGTGGGGTTGGTGGGGGCCTTTTGTACTATCTCCC
TTAATTTGCATGAAAAGCTGAAATTAGTGACCGTCAAATACTGTTGTTTTCAATATTATATATTCATTAACTTTATAATTTCTTTACATGAATTGGTAGATTATCATGCTAAGTGCTTCT
GCAAATAAGTTATCAAGATTAAAAGAACAAGCAGAGGAATACGCAGCTTTGATCATGGAAGAGTTGGACCCAGAAAGATTTGGCTACATCGAG
GTGCGGGTCCTCTTTAATTTTACTGAC
AGATAAACGCTAATGTTTTTTTTTCCATTCTTTTTTCATGCATGTTTGGTAAATCCCATGAAATACTATAGCGATTCTAGAATCAATTAGGTGAGCTTAGTATAATATTTATCTTCATTA
TTTATTTTCATACTGGGTTCCAAGCATTATTTAACTAAATTTGTTTAATCATAGTCAAATTTGATCCCTTGTCTTGTTCTGGGTCGCAATAATCAACAGGGGAAAAAAATAATAAAAAAG
AGGCACAGCAGTTGCAATTTTATAGCAAAGTCCAAAGTCCATGTTCCTAACAAATTAATTCACCAAATCTTACTGGGTCTCGATGTTGTTGAACCGTACTCGAAGAAAGAATGACAGAAG
AAGAGAGAAATGGCAATCGTTTCTTACAAATGGCACAACTAATTAATCTGGTTAAGCAAGCTTATTTATATTGAAGAATATTTGTGGTAGTTGAACAGCTCCCTGGCTTTCTTTTCCACT
TTAATATGCACGTCTGTTATAGCATAGAAGACTTTTAAGTTTTAAGTAGAGGTACGCAGTTTCTGAGGCAAAGCTGGTTCAAACTTCAGATGTTTTTAGGACCAGTACTAACATTAAAAA
AAAAAAAAAGGTTGTCCACCAAGTAATGATAAATTCAACGAAAACTTGAACGTGAATGGCCATCGTCTAACACAGTTGTCATTGTCACCAACTAACTCAAGATTTTCTTAAGCGTCTTTC
TTCAATTTGGTAGGGTAAATATTGATTCTTTATCCAATAGGCTTTCGAATTACGTACTGTCATTCCTCTTGTTGTCAAAATGGAACGAACCTTTTGAAGATTTCTAAGAGCATGAACCTT
TACCACTCCAGATTTTATATGGATCCTAGAGACTGGCTCGGATGGAAGGACAGTTTATTTCTCATGGTAGAGGATCGAGATTTTAAATATAAATAATTTATTCACGATCCAAGTAAGAAA
AGAAAGGATGGAGGTCGGCGTACAGCTAAATAAACAAGTGTTATCTACTGTATCGGAAGTGCCTTGATGACCTGTACTTTTTTTAATTTTAAAATTGATATTGATGATCTGAACTATTAT
TCCTGCCACTGTTTGAACCTGACCTCTCAAATAATGCTTAGCCTTCACTCATACATAAATCATTACGCGTGCTCCACTCTGCATCAATTGTAGTGTAATAAGTTGACATGACCAAGATTC
TCTTTTCCATTATATGTATAACTCCACTGCTGATGATTTGATGCAACCTTCTTGTTTTCTTGTTGTTGCTTAAAATGATATGTAGCTATGGCAGCTAGAAACACTCCTTCTACAAAAGGA
CACGTATCTGAACTACAGTCAAGCTCTGAGCTACACAAGCCAAGCCTTGAGCCAAAATCTACAAGGGCTAAGAAAGAGGAGCCCAATAAGGAGAGTGAGCAAGCAATGCGTATACTTTTT
TCAAGAGAATTGGAGAAGAATTTGGGTTTTGACATTATGGGTTATGATAATGATAGGGCTGTTCGCATGGAAATTCTTTCAATACAAGCAAAAGAATGCTTTTCAAGTAATGGGTTATTG
TCTCCTAACAGCCAAAGGTGCAGCAGAGACATTGAAGTTCAATATGGCTCTAATTCTCTTGCCTGTGTGTAGAAATACTATCACTTGGCTGAGGTCCACTAGGCTGGGTCCCTTGGTGCC
TTTTGACGACAATATCAACTTTCACAAG
GTACGTCCAAGGTTACCGACCCCCTCCTCTTCTTGTCTGTATTGCTTTTTTAATACGTTTACATCCTTCTAGGGTCCCATATAGAAGACTTT
GCAAGAAAGTCAATATATTAGTTGATCTTAGCCAATGAAAATACAATAATTTTTCAGTGCCTAAAATATTGATCCCGAGATGGCAGCAATAGCTGGCAACTTAAAGGCTTTCATATATAC
CCCTCTTTTTTTATTAAATAATGTTAGCCACAGCATATGAATTTTGTTGCCGAAGAAGGAATTTGAAAGAAAAGAGCCACATAAATCGATAATTTTGTATTGTTTTATTTAGTTCTTATT
TTTTTATAAATAAAATTATAATTTTTTTACACCTTGTAAAATTGTTTATTAAAATTTGTAATTTCTTTATTTTTAAATAGATATTTTATTTATTGATATATTTGATTACTTATTTTCTTA
TGATTATGTTTTATGAATTACACAAATAAAATTACTTTTTCATTTTTTCATTATTATTTATAAACTATTTTCCAAAAAATTGATTACTTTTACTTTAAAACAAATTATTTTATTTTATTT
TATTTTTCATAAATAAATATTTATTTTTAAAAGTAATTATCTTTTATTAAATTATTTATTTTCATGCAAACACCAACCAGCTTTATAAAATACTTGTGTTGTAATGGCTTGTGCTTTCCC
GTGACCAAACATGTTCTTAAATTCGTGTTTGGTAACGAGGACACTTCGTCGAAATGAATTACAATTTGTTCTCTCTTTTCATTTGGTTAAACTTAGGGGAGATGGGTCAAATCTAAAGGA
TTATTCCTATTGTGGGGATTTGATCTTCGTAAACTCTTGTCTTTTCCAAGGGCTACTACACGGGGCTTGTAGCTCAGTGGCCTTGGCAGGCTTTGCCCTGCCTGAGTGCCCTGGTTCGAG
CTCTGTTGTGTACCCAGCACTTGAGGGTCTAACTGCTGTGGTCCATTGTGGACTTGTTCCGCCCCCTCCCGGGTTCGACCCTCTATGTGCACGCCTGTCACCCCCGCGGTGCCTTACCTG
CTCCTGGGCTTGCAGGATGTCCAGTGGGCCGTGGGGAATAGTCGTGGTGCGCGTAAGCTGGCCCGGACACCCCACGTGAATAAAAAAAAAAAAAAAAAATTAGCGAATAAATACATAAAC
AACTTTTTTGTTTATTAAATTCTCATCAGTTAAAGGCTCTGCGTATGCTAGCTAAGACCCAAATGCTCCGTGTGCTATAAAATAAAAGAGTAAATTCATAACTAATTCAAAGCTATTTTA
CCACTGATAAAAGATATTGAAAATTTCAGTCGAGCTTAAATCAATCTTGATGATGTACAAAATGACACCATTTAATCACAAAATGATTTATATATATATATAAACTTGTTTAATTACTTG
TGGTAAATTGCATTGATTTAATATTTCTCACACACATGCAGACCATAGCAGCAGCAATTGTAATTGGTGTGATTCTCCATGCTGGAAACCATCTAGTCTGTGATTTTCCAAGGCTTATTA
ATTCATCTGATGAGCAATATAGAGCATACCTGAGTGATGACTTTGGTGGAAACAAACCTTCATATGCAAAACTGGCTAGAGGGACTGAAGGTGTGACTGGAATCTTAATGGTGATCAGCA
TGGCCATTGCATTTACACTTGCAACAAGATGGTTCAGGAGGAGCCTCATTAAGTTTCCAAAACCCTTTGACAGGCTCACTGGATACAATGCATTCTGGTATTCGCACCACTTGTTTGTCA
TTGTCTACATCCTGCTCACCATCCATGGTGTATTCCTGTATATGGTGCATAAATGGTACAAAAAGACG
GTATGAATCTGAAATCTTTTAATGGCAGTGAATGTTTTTCTTGTTTGAGATT
GTAAACTGACGGCATTTTATTGCTTGCAGACATGGATGTATCTTTCTGTTCCAGTTTTACTATATGCCGGAGAAAGGGCGCTGAGGTTTTTTCGTTCTGGCTTCTATACTGTCAGGCTTC
TCAAG
GTATAACATCCTGAAGACCTCTGTCATTTCAGTTCGATCTTATGGTTAATGTCTAAATGTTACCATCTTGAAAGAGCCCTATAAACTGGCACAGTACTTCTGTAAAGTTTAAAAC
CTACTGTACTAGATTTTTGTCATAATTCTTTTTTTCATCCAGGTTGCAATTTATCCTGGAAATGTTCTCACATTGCAAATGTCTAAGCCTCCCCAATTCCGGTACAAGAGTGGACAGTAC
ATGTTTGTCCAGTGCCCTGCTGTTTCTCTATTTGAGTG
GTAAATCACTATTAATTTCTTAACTCACATGAAAATGGCTTTTTTGGTAGTTTAAAAAAACTCAGTTGTAGTCTACCAGAGA
AAGGTGCTTGTAAAATACATCTAGGCCAACTGCTAGCAAGAAACTTGCTCATTTTGTGCTTATTCTCTTTATGGGATATGGTCATTATTTTGTATGATTTTTTTTTCATTTTCTGATGAA
AGCTAGTGAAAAATAAATTTGATAGGAATCAGTATTTGATTTCTTTCTTTTGTAATTGATGATCGATTGATGCCAACGGTTTCAGTTGGTTTCTTTGCTCTGATACCTGATTTTCTCCAG
AACTTACAATCAGCATGCTTTATTTTTCCACCCAGGCATCCATTTTCAATTACCTCCGCACCTGGTGATGACTACCTCAGTGTTCACATTCGGCAGCTAGGTGACTGGACTCAAGAACTA
AGAAGAGTGTTCTCTGAAGCCTGTGAACGTCCTGTAGCCGGTAAGAGTGGACTTCTCAGGGCTGATGAAACAACAAAAAAAAG
GTACAGAATATGTCTATGTTTCCCTTTTCTTTTCCCA
TTCCCTTTTTTTTTTTTTCCTTTGGATAGCATTTTGTGATTATATTGTTTATGTAACTTTCCTCTCTAATGACAGCTTGCCAAAGCTCTTGATAGATGCGCCTTATGGTGCACCGGCACA
AGATTACCGTAAATATGATGTGTTGTTACTTGTTGGTCTGGGAATTGGAGCAACACCTTTCATCAGCATTCTCAAAGATCTTCTTAATAACATTGTCAAAATGGAGGAGCAAGCA
GTAAG
TGACTAGAAACCTGACTTTCACTTTTCCAATCTGCAATTTATACACATGATCGTTCCTTTAATACTATAGATTCTGTATTGCGAACTATAGAAAATTTCCAGACTTAATCCATGATAATC
TTCTAAATGCACAGTCACAAGTCTGATTCTCATTCTCAGGATTCGGTCTTGGATATCAGTAGGACATCAGACCTGAGCATTGGAAGCAATGATACATCAACCTCTAACAAAGTTTCACCA
AAACGTAAGAAGGCTGTAAGGACCACCAACGCTTATTTCTATTGGGTAACAAGGGAGCAAAGTTCTTTTGATTGGTTCAAAGGAGTCATGAATGAAGTTGCAGAGCTTGATCAAAGG
GTA
ATTAATGTCACCTTAGCTTGAAATTATGTAAATTACAAAAAAAATTCCCGTTTTGCTTGGTTTCCTTGATTGTTGACTTTGTCGTTGGACTATTCCAGGGTGTGATTGAGATGCATAATT
ACTTGACCAGTGTGTATGAGGAAGGCGATGCTCGATCAACCCTCATTACCATGGTCCAAGCCTTAAACCATGCGAAAAACGGTGTGGACATTGTCTCCGGGACCAGG
GTAATACTAATTA
TTTTGTTTAGGCTCATTGCATGTTCATGTTGCGGCTCGCATGTTATATCAGTTGGGCTTTTCCAAATTTTCTGACACCTTCAATTACACATAAATTACACTCTGTGCAGACAAGTGACAA
TAGTGGACTGAAATATTTGACCATGCAGGTCTACTAACAATTCCTCGTTTTATCATTAGGTGCGAACGCATTTTGCAAGGCCTAATTGGAAGAAGGTTCTTTCTAAATTATGTTCCAAGC
ACTGTAATGCAAGGATAG
GTGATTATACCTTCTAGCTAACAGATTTTTTAACAGAGAAAACCTATCCTCCTGTTCTAATCACATCACTATGGTTTTGGAGCAGGTGTGTTTTACTGCGGA
GCACCTGTCTTGGCTAAAGAACTAGGCAAGCTCTGCTATGATTTCAATCAAAAAGGTTCCACAAAGTTCGAGTTCCACAAGGAGCATTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAGCTTCATTGCCTAAACACGAGCGGAGATGGGCCTCGGACACGCTTCCCGGCAATGCAACGATGAGCACCGGAACATCGCCGGGAACTGAGTCCGGCGAGGAGTTTGTTGAGGTG
ACACTTGATTTACAAGGTGATGACACGATTGTGCTTCGTAGTGTTGAGCCAGCAACATCAACGGTTATCAACATCGATGATGTTTCTTTCACTACTGGTGGTTCTGTGTCTGCCGGAGCT
GTAACTCCGGTGTCGAGATCGCCGACGATCAGGCGGAGTTCGTCGAATAAGTTGTTGCAATTTTCTCAGGAGTTGAAAGCTGAAGCTGTAGCGAAAGCTAGGCAATTTTCGCATGAGTTG
AAAGCTGAGTTAAGGAGGTTTTCTTGGAGTCATGGACAGGCAGCTCGGATTTTATCAGCCTCGGGAAATAATGGCGGTGGTGCTTTTGAGTCAGCTTTAGCCGCCCGTGCTTTGAGAAAG
CAGCGAGCGCAGCTGGACCGGACTCGGTCTGGTGCTCACAAAGCCTTGCGTGGATTGAGATTTATAAGTAAGAACAGTAAAAAAACTAATGGCGTTGATGCATGGAGTGAAGTTCAAAGC
AATTTTGAAAAACTTGCTGAAGATGGTTATCTTAACCGGGCCGATTTTGCACAATGCATAG
GAATGAAAGATTCGAAGGAGTTTGCTTTGGAGCTTTTTGATGCATTGGGAAGGAGAAGA
AGATTGAAAGCGGACAAGATTTGTGGAGATGAGCTTTACGAGTTTTGGTCACAAATTACCGATCAAAGCTTTGATTCTCGACTCCAGATCTTCTTCGATAT
GGTGGACAAGAACGAAGAC
GGTAGAATCACTGAAGAAGAAGTCAAAGAG
ATTATCATGCTAAGTGCTTCTGCAAATAAGTTATCAAGATTAAAAGAACAAGCAGAGGAATACGCAGCTTTGATCATGGAAGAGTTGGAC
CCAGAAAGATTTGGCTACATCGAG
CTATGGCAGCTAGAAACACTCCTTCTACAAAAGGACACGTATCTGAACTACAGTCAAGCTCTGAGCTACACAAGCCAAGCCTTGAGCCAAAATCTA
CAAGGGCTAAGAAAGAGGAGCCCAATAAGGAGAGTGAGCAAGCAATGCGTATACTTTTTTCAAGAGAATTGGAGAAGAATTTGGGTTTTGACATTATGGGTTATGATAATGATAGGGCTG
TTCGCATGGAAATTCTTTCAATACAAGCAAAAGAATGCTTTTCAAGTAATGGGTTATTGTCTCCTAACAGCCAAAGGTGCAGCAGAGACATTGAAGTTCAATATGGCTCTAATTCTCTTG
CCTGTGTGTAGAAATACTATCACTTGGCTGAGGTCCACTAGGCTGGGTCCCTTGGTGCCTTTTGACGACAATATCAACTTTCACAAG
ACCATAGCAGCAGCAATTGTAATTGGTGTGATT
CTCCATGCTGGAAACCATCTAGTCTGTGATTTTCCAAGGCTTATTAATTCATCTGATGAGCAATATAGAGCATACCTGAGTGATGACTTTGGTGGAAACAAACCTTCATATGCAAAACTG
GCTAGAGGGACTGAAGGTGTGACTGGAATCTTAATGGTGATCAGCATGGCCATTGCATTTACACTTGCAACAAGATGGTTCAGGAGGAGCCTCATTAAGTTTCCAAAACCCTTTGACAGG
CTCACTGGATACAATGCATTCTGGTATTCGCACCACTTGTTTGTCATTGTCTACATCCTGCTCACCATCCATGGTGTATTCCTGTATATGGTGCATAAATGGTACAAAAAGACG
ACATGG
ATGTATCTTTCTGTTCCAGTTTTACTATATGCCGGAGAAAGGGCGCTGAGGTTTTTTCGTTCTGGCTTCTATACTGTCAGGCTTCTCAAG
GTTGCAATTTATCCTGGAAATGTTCTCACA
TTGCAAATGTCTAAGCCTCCCCAATTCCGGTACAAGAGTGGACAGTACATGTTTGTCCAGTGCCCTGCTGTTTCTCTATTTGAGTG
GCATCCATTTTCAATTACCTCCGCACCTGGTGAT
GACTACCTCAGTGTTCACATTCGGCAGCTAGGTGACTGGACTCAAGAACTAAGAAGAGTGTTCTCTGAAGCCTGTGAACGTCCTGTAGCCGGTAAGAGTGGACTTCTCAGGGCTGATGAA
ACAACAAAAAAAAG
CTTGCCAAAGCTCTTGATAGATGCGCCTTATGGTGCACCGGCACAAGATTACCGTAAATATGATGTGTTGTTACTTGTTGGTCTGGGAATTGGAGCAACACCTTTC
ATCAGCATTCTCAAAGATCTTCTTAATAACATTGTCAAAATGGAGGAGCAAGCA
GATTCGGTCTTGGATATCAGTAGGACATCAGACCTGAGCATTGGAAGCAATGATACATCAACCTCT
AACAAAGTTTCACCAAAACGTAAGAAGGCTGTAAGGACCACCAACGCTTATTTCTATTGGGTAACAAGGGAGCAAAGTTCTTTTGATTGGTTCAAAGGAGTCATGAATGAAGTTGCAGAG
CTTGATCAAAGG
GGTGTGATTGAGATGCATAATTACTTGACCAGTGTGTATGAGGAAGGCGATGCTCGATCAACCCTCATTACCATGGTCCAAGCCTTAAACCATGCGAAAAACGGTGTG
GACATTGTCTCCGGGACCAGG
GTGCGAACGCATTTTGCAAGGCCTAATTGGAAGAAGGTTCTTTCTAAATTATGTTCCAAGCACTGTAATGCAAGGATAGGTGTGTTTTACTGCGGAGCA
CCTGTCTTGGCTAAAGAACTAGGCAAGCTCTGCTATGATTTCAATCAAAAAGGTTCCACAAAGTTCGAGTTCCACAAGGAGCATTTCTAA

Retrieve as FASTA