Entry information : PtRboh09 (POPTR_0006s13950 / Potri.006G137300)
Entry ID 6080
Creation 2008-01-28 (Christophe Dunand)
Last sequence changes 2008-01-28 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-11 (Christophe Dunand)
Peroxidase information: PtRboh09 (POPTR_0006s13950 / Potri.006G137300)
Name (synonym) PtRboh09 (POPTR_0006s13950 / Potri.006G137300)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtRboh09
start..stop
S start..stop
VvRboh07 1461 0 10..926 8..917
LuRboh189 1415 0 1..926 1..955
CclRboh04 1407 0 16..926 12..910
EgrRboh01 1394 0 12..926 3..925
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11202253..11202853 601 N° 2 11202948..11203107 160 N° 3 11203405..11203453 49 N° 4 11203925..11204038 114
N° 5 11204623..11205045 423 N° 6 11205291..11205674 384 N° 7 11205752..11205847 96 N° 8 11205944..11206059 116
N° 9 11206158..11206328 171 N° 10 11206419..11206578 160 N° 11 11206672..11206860 189 N° 12 11206978..11207106 129
N° 13 11207268..11207346 79 N° 14 11207499..11207608 110  
join(11202253..11202853,11202948..11203107,11203405..11203453,11203925..11204038 ,11204623..11205045,11205291..11205674,11205752..11205847,11205944..11206059,112 06158..11206328,11206419..11206578,11206672..11206860,11206978..11207106,1120726 8..11207346,11207499..11207608)


exon

Literature and cross-references PtRboh09 (POPTR_0006s13950 / Potri.006G137300)
DNA ref. Phytozome 11:   scaffold_6 (11202253..11207608)
Cluster/Prediction ref. Genebank:   18100289
Omic ref. ePlant:   Potri.006G137300
Protein sequence: PtRboh09 (POPTR_0006s13950 / Potri.006G137300)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   926
PWM (Da):   %s   105212.12 Transmb domain:   %s   o364-386i499-521o548-570i727-744o
PI (pH):   %s   9.66
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKSTSSFGRTSSRLSNYSRTFDLPDDDLDGSETASDCEIGGAMLPIFLNDLRRNNQDELVEVTLELEKDSIVVCSVNPNGRGMSTPSTPGGGAAAGILERSLSATSRIRRKFGWLRSRSSRTTWSENEERVISARDARKLKAKLDRSKLSAQRGLKGLRFINKTTGTTSESNELWKRVESRFKLLSKDGLLAREDFGECIGMVNSKEFAVCIFDALARRKRQRITKISKEELHDFWLQISDQSFDARLQIFFDMADSNEDGRIIREEVQLIMLSASANKLSKLKEQAEEYASLIMEELDPENLGYIELWQLETLLLQRDTYMNYSRPLSTASVSWSQNISSIKPRNVMHRLSFKLRNLILEKWQRAWILSLWVMIMVGLFVWKFLQYKNKAAFHVMGYCLASAKGAAETLKFNMALILLPVCRNTLTWLRSTRARSFVPFDENINFHKMVAGAIVIGVILHAGNHLLCDFPRLINSSPENFALIASDFNNKKPTYKELVTGIEGVTGISMVVLLTIAFTLATGRFRRNGVRLPAPFNKLTGFNAFWYSHHLTGVVYILLLVHGTFLFLAHKWYQKTTWMYISAPLLLYMVERNVRTRRSEHYSVKLLKVSVLPGNVLSLILSKPQGFKYKSGQYIFLQCPAISSFEWHPFSITSAPGDDYLSVHIRIVGDWTEELKRVFTEENDSPSVIGRAKFGQLGHMDQTRQPKLYVDGPYGAPAQDYRNYDVLLLVGLGIGATPFISILRDLLNNTRTADNQDSNTENSRSDDSSNSYASSSMTPVSKKRTQRTTNAHFYWVTREPGSFEWFKGVMDEVAEMDHKGQIELHNYLTSVYEEGDARSTLITMVQALNHAKHGVDIVSGTRVRTHFARPNWKEVFNKIASKHPFGTVGVFYCGMPVLAKELKKLCQELSHKTTTRFEFHKEYF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6, 13 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAATCAACTTCGTCGTTTGGGAGGACGAGCTCCAGGCTATCCAATTACAGCCGCACGTTTGACTTACCAGACGATGATCTCGACGGTTCAGAAACCGCCAGCGACTGCGAGATTGGC
GGTGCAATGTTGCCGATTTTCTTGAACGACCTGAGAAGAAACAACCAAGATGAGTTAGTTGAGGTCACGCTCGAGCTCGAGAAAGACTCCATTGTTGTTTGCAGTGTTAATCCGAACGGT
AGAGGTATGTCAACTCCGAGTACGCCTGGCGGTGGTGCTGCGGCGGGGATTTTAGAGAGGAGTTTGTCGGCAACGTCGAGGATTAGACGGAAGTTCGGGTGGTTAAGATCAAGATCTTCG
AGAACGACATGGTCGGAGAATGAAGAGAGAGTAATCTCGGCGAGAGATGCACGGAAATTGAAAGCCAAGCTTGACAGGTCAAAACTGAGCGCTCAAAGAGGACTGAAAGGGTTGAGGTTT
ATAAATAAGACAACCGGTACGACGTCTGAGTCGAATGAGCTGTGGAAACGAGTCGAGTCCAGGTTCAAGTTGCTTTCTAAAGACGGTTTGCTTGCTAGAGAAGATTTTGGTGAATGTATA
G
GTAAATAGTTACTCAATAATAATCACTGGTTAAAAATAAATAATTTTATGTTTGTTGTTGGGTTTCTGACATGGTGTGTGAGCTATTGTGTTAGGGATGGTGAATTCGAAGGAGTTTGC
GGTGTGTATATTTGATGCACTAGCGAGGAGGAAGAGGCAGAGAATAACGAAAATAAGCAAAGAAGAGCTTCATGATTTCTGGTTACAGATTTCTGACCAGAGTTTTGACGCGCGCCTTCA
AATTTTCTTTGACAT
GTGCGTCTCTCTCTCTCTCATTTTTTTCACCCTCGAATGTTTTGAAAATCATAGTAGCAATTGGGATTTGACGATCTTTAAGTTCTACGTACAAACTCAACGGTG
GTGTTTCAGACTGTAGCATAAATCTCAGGTGGTAAGCATGCATGACCACCGTCGTCTCGATCTGCCTATATTTTTCGGGCGTTTGATCAGTACTTCTCAGACAAGTTCCAGGGCTCTTTA
ATTAATCTGCTGATAGTCTGGTTTTAATTCCAATCGGAAAACGAGAAACCTGAAACTTCTGGTGCATTGCAGGGCAGATAGCAATGAAGACGGAAGGATCATAAGAGAAGAAGTGCAGGA
G
GTAATAATATTTTCAGTAGTATAATATTATTCTCCCAAAAGATTCCTAAATAATATTACACTACTGACTGAGATGCACAATACCAACTATGATAGAGTTGCTATTCGAAGAAATAATTC
AATTAGATTTATTATTTTCGGGTGAAAAACATTAATAATTGTTTATTCCTGAGTTGTTGTTTCGCACGCATTCACCGGTTTTAGAAAGTGGTATTATTTCTTAATTCTTTTAGCATTAAA
ATATATAGGTTTCTCACAAATTAAGCAAATTAATCGGAGACATGTTTTACAACTGTGTTAACTACCATCAATCAAATCAAAGTATTTGTCAAGAAGCATATTTACATGACAACACCCTAC
ATTTCTTTTTTTTTAATTTATTATTATAAAGTAGTTAGTTATATGCACATCATGAGCAACCGATGCCAGATAATATTTTAACTGTGACATTATTACTTTCTTTTAATCCCAGCTTATAAT
GCTCAGTGCTTCTGCAAATAAACTGTCAAAGTTGAAAGAACAAGCAGAAGAATATGCTTCGTTGATAATGGAAGAACTTGATCCTGAAAACCTCGGATACATTGAG
GTAAATCACAAATT
CAACCTTCAAATGATGATCAAGCTGATTGTTTACCTCAGTTCCAGCTTTTTGAATAGGTTAATAGTCGGTTTATTTGTGTTTTTGATATTTTTTTGTTTTAAATTAATTTTTTTAACGTT
CTTATATTGTTTTGGTATGTTAATATAAAAATAATTTTTTAAAAAAATATTATTTTAATATAATTTCAAACAAAAAATAATTTAAAAAATAACTATTAATATAATATCAAATAAAATTAA
TAAATTATTTTTAATTTAGCCTACCTTACATTCAGCCCGAGGACTCCTCGGGCCTCGTCATGAAAACCACAAATCATGTAGTGGATGCCACAAATCACTGAATTTACTATATTTCTTTCT
TTTATTGGTTTCATGATTTATTATAAATTTATGATTCATGTACTTGTATTTAATATTCAGTAATAAAGTCACCGGAAGATTCATGACTAAAAAAAGTAACGGGAAGTTTTCTTGACTTTT
TCAGTCCTCCAACTTACAATTGGGCTTAGTCTTTTCATTTAAAAAAAAAAAAAAGATTTAAGAGAAAAAAGAGTTATTTCCCATTTTCAGTTATGGCAGTTAGAGACACTTCTTCTACAA
AGGGACACATACATGAACTACAGCAGACCATTGAGTACAGCAAGTGTAAGCTGGAGTCAGAACATAAGTTCAATCAAACCCCGGAACGTGATGCATAGGCTAAGCTTTAAATTGAGGAAT
TTAATTCTAGAGAAATGGCAAAGGGCATGGATTTTATCGCTGTGGGTGATGATAATGGTTGGCCTATTCGTCTGGAAATTCCTTCAATACAAGAACAAGGCTGCATTTCACGTCATGGGC
TATTGCTTGGCGAGTGCCAAAGGTGCTGCAGAGACTCTCAAATTCAACATGGCTCTAATTCTATTACCTGTTTGTCGAAACACACTGACTTGGCTTCGGTCCACTCGAGCAAGGTCATTT
GTTCCTTTTGATGAAAATATTAATTTCCACAAG
GTAAGAAGGCTTACTATGCTAATTATATATAATTGACAAAGGATTTGGACAGGTTAATTAATAGATAAAAAGAAATCAAATTCATAT
ACGATTTGCCTTTGCTTAAGGTTCTGTTCATAATTAATGATGGAGCAACAATCCGAGATTCTACAAGCCAAACAAATGAAAGAAGTGAATATTTAATAGAAACATGCTAAAAACATCGTC
AGTCCCTGACCCCCCTTTCTTTTACCTTATTTTCCCAGATGGTTGCAGGCGCTATAGTAATTGGAGTCATCTTGCATGCAGGAAACCATCTATTATGTGACTTTCCCCGTCTGATAAACT
CGTCTCCTGAAAATTTTGCCTTGATTGCGTCTGATTTCAATAATAAAAAGCCTACATATAAAGAACTTGTGACTGGTATTGAAGGCGTGACTGGGATTTCTATGGTGGTGTTATTGACCA
TTGCATTCACTCTGGCAACAGGCCGCTTCCGGAGAAATGGGGTGAGACTACCTGCACCCTTCAACAAATTGACAGGTTTCAATGCGTTCTGGTACTCTCATCATCTTACTGGTGTGGTCT
ATATTCTGCTGCTCGTCCATGGAACCTTCTTGTTCTTAGCCCACAAGTGGTATCAGAAAACA
GTAAGAACTTTCGAAGCTTTTGTGACAAGATAATCAATAATTAGCAAGTAACATCTGT
TATTTTTCTGATTTTCCAGACGTGGATGTATATCTCTGCTCCCTTGCTGCTCTACATGGTTGAACGAAATGTGAGAACACGTAGATCAGAACATTATTCTGTAAAATTATTGAAGGTAAT
TAGTCAAGTTCTTGGAGGCTTTAGCGCTGCTTTCTAGATGATCTCTTGTTTTTCTTGGCAAGAAGAGTCTAACATGACCTGATTCGGATAGGTGTCAGTGCTACCGGGAAATGTCCTAAG
CTTAATCTTGTCCAAGCCACAGGGATTTAAGTACAAAAGTGGGCAGTACATTTTTCTACAATGCCCAGCAATTTCCTCCTTTGAATG
GTAGTGTTTCTGAAAATAACAACTCCTGTTAAT
TACAATAATTATTATTATTATGAAATATGATCATGTTTCAAAGAAATGAACCTAGTCCCTTTCAGGCACCCATTCTCTATAACCTCAGCACCAGGGGATGACTATCTCAGTGTTCACATC
CGGATAGTCGGAGACTGGACGGAGGAATTGAAGCGAGTTTTCACCGAGGAAAATGATTCACCATCTGTTATTGGTCGTGCCAAATTTGGTCAACTTGGGCACATGGATCAAACAAG
GTTA
TTTAAACACTGAGCAACTCCACTGTATTAGACTTGCATTCAAACAATTTGTGAAAATATTGAGGCAAAATGCCTGCATTGCTGCAGACAACCAAAGCTGTATGTTGATGGTCCATATGGG
GCTCCAGCACAAGACTACAGAAATTACGATGTCTTGCTTCTCGTGGGGCTTGGCATAGGAGCTACCCCTTTCATAAGCATCCTTAGAGATCTTTTGAATAATACACGAACAGCAGATAAT
CAAATG
GTAAATGTCATTCCCTGAGATTTCATCTGTGCATATTATACTATTATAAAGTGAAGATTTACATCCAGCAATTGATTTTCTATGTTTTACTAGGATTCAAACACTGAAAACAGT
CGGTCAGATGACAGTTCAAATAGTTATGCATCTTCAAGTATGACACCAGTTAGCAAGAAGAGAACACAGAGGACTACCAATGCTCATTTCTACTGGGTTACTAGAGAGCCTGGATCTTTT
GAATGGTTTAAAGGAGTCATGGATGAAGTTGCAGAGATGGATCACAAA
GTAAGACAAAAACTTCCAACCCATGTTTCATTATCCATGTCTCAAATAAATTGCCACGGCTATCATTACAAA
GTGATAGGTATTAACCTTCCCTCTTCTTATATAACAACAAAATAGGGTCAAATCGAACTGCACAACTACCTTACAAGCGTTTACGAAGAAGGTGATGCAAGGTCAACTTTGATCACCATG
GTCCAAGCTCTCAATCATGCGAAACATGGTGTTGACATCGTGTCAGGCACTCGA
GTATGTTCCCTGATAAATATAAAGTTTTAGGTTGTCAAAATTACTGTAGACAACAAGGTCAACCCG
CCAATCAATAACTGGTGGGAGCTGGGAAATCAAATATTCAAAGCACCGCAGGGGGGAAGAAAACTTATTCATCATTTGGCTCTATTTTGTTGCAGGTGAGGACACACTTTGCAAGACCAA
ATTGGAAAGAAGTGTTCAACAAAATTGCTTCAAAGCATCCGTTTGGCACAGTAG
GTAAGGAAAGCATACAAATTAATAAAACACCATTTTCATGTAATGACCAGATTACGGTTGAAAATA
CAAGGCATCGATCTTCTGCAATCTTTTGGTAATAGACAAGTATTATAATTTTTTACTAAAAAACAGCTTGTTAAATTACAATGCAGGGGTGTTCTATTGCGGGATGCCAGTGTTGGCAAA
GGAGCTGAAGAAGCTATGCCAGGAGCTGAGTCACAAGACAACCACAAGGTTTGAGTTTCACAAGGAGTATTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAATCAACTTCGTCGTTTGGGAGGACGAGCTCCAGGCTATCCAATTACAGCCGCACGTTTGACTTACCAGACGATGATCTCGACGGTTCAGAAACCGCCAGCGACTGCGAGATTGGC
GGTGCAATGTTGCCGATTTTCTTGAACGACCTGAGAAGAAACAACCAAGATGAGTTAGTTGAGGTCACGCTCGAGCTCGAGAAAGACTCCATTGTTGTTTGCAGTGTTAATCCGAACGGT
AGAGGTATGTCAACTCCGAGTACGCCTGGCGGTGGTGCTGCGGCGGGGATTTTAGAGAGGAGTTTGTCGGCAACGTCGAGGATTAGACGGAAGTTCGGGTGGTTAAGATCAAGATCTTCG
AGAACGACATGGTCGGAGAATGAAGAGAGAGTAATCTCGGCGAGAGATGCACGGAAATTGAAAGCCAAGCTTGACAGGTCAAAACTGAGCGCTCAAAGAGGACTGAAAGGGTTGAGGTTT
ATAAATAAGACAACCGGTACGACGTCTGAGTCGAATGAGCTGTGGAAACGAGTCGAGTCCAGGTTCAAGTTGCTTTCTAAAGACGGTTTGCTTGCTAGAGAAGATTTTGGTGAATGTATA
G
GGATGGTGAATTCGAAGGAGTTTGCGGTGTGTATATTTGATGCACTAGCGAGGAGGAAGAGGCAGAGAATAACGAAAATAAGCAAAGAAGAGCTTCATGATTTCTGGTTACAGATTTCT
GACCAGAGTTTTGACGCGCGCCTTCAAATTTTCTTTGACAT
GGCAGATAGCAATGAAGACGGAAGGATCATAAGAGAAGAAGTGCAGGAGCTTATAATGCTCAGTGCTTCTGCAAATAAA
CTGTCAAAGTTGAAAGAACAAGCAGAAGAATATGCTTCGTTGATAATGGAAGAACTTGATCCTGAAAACCTCGGATACATTGAG
TTATGGCAGTTAGAGACACTTCTTCTACAAAGGGAC
ACATACATGAACTACAGCAGACCATTGAGTACAGCAAGTGTAAGCTGGAGTCAGAACATAAGTTCAATCAAACCCCGGAACGTGATGCATAGGCTAAGCTTTAAATTGAGGAATTTAATT
CTAGAGAAATGGCAAAGGGCATGGATTTTATCGCTGTGGGTGATGATAATGGTTGGCCTATTCGTCTGGAAATTCCTTCAATACAAGAACAAGGCTGCATTTCACGTCATGGGCTATTGC
TTGGCGAGTGCCAAAGGTGCTGCAGAGACTCTCAAATTCAACATGGCTCTAATTCTATTACCTGTTTGTCGAAACACACTGACTTGGCTTCGGTCCACTCGAGCAAGGTCATTTGTTCCT
TTTGATGAAAATATTAATTTCCACAAG
ATGGTTGCAGGCGCTATAGTAATTGGAGTCATCTTGCATGCAGGAAACCATCTATTATGTGACTTTCCCCGTCTGATAAACTCGTCTCCTGAA
AATTTTGCCTTGATTGCGTCTGATTTCAATAATAAAAAGCCTACATATAAAGAACTTGTGACTGGTATTGAAGGCGTGACTGGGATTTCTATGGTGGTGTTATTGACCATTGCATTCACT
CTGGCAACAGGCCGCTTCCGGAGAAATGGGGTGAGACTACCTGCACCCTTCAACAAATTGACAGGTTTCAATGCGTTCTGGTACTCTCATCATCTTACTGGTGTGGTCTATATTCTGCTG
CTCGTCCATGGAACCTTCTTGTTCTTAGCCCACAAGTGGTATCAGAAAACA
ACGTGGATGTATATCTCTGCTCCCTTGCTGCTCTACATGGTTGAACGAAATGTGAGAACACGTAGATCA
GAACATTATTCTGTAAAATTATTGAAG
GTGTCAGTGCTACCGGGAAATGTCCTAAGCTTAATCTTGTCCAAGCCACAGGGATTTAAGTACAAAAGTGGGCAGTACATTTTTCTACAATGC
CCAGCAATTTCCTCCTTTGAATG
GCACCCATTCTCTATAACCTCAGCACCAGGGGATGACTATCTCAGTGTTCACATCCGGATAGTCGGAGACTGGACGGAGGAATTGAAGCGAGTTTTC
ACCGAGGAAAATGATTCACCATCTGTTATTGGTCGTGCCAAATTTGGTCAACTTGGGCACATGGATCAAACAAG
ACAACCAAAGCTGTATGTTGATGGTCCATATGGGGCTCCAGCACAA
GACTACAGAAATTACGATGTCTTGCTTCTCGTGGGGCTTGGCATAGGAGCTACCCCTTTCATAAGCATCCTTAGAGATCTTTTGAATAATACACGAACAGCAGATAATCAAATG
GATTCA
AACACTGAAAACAGTCGGTCAGATGACAGTTCAAATAGTTATGCATCTTCAAGTATGACACCAGTTAGCAAGAAGAGAACACAGAGGACTACCAATGCTCATTTCTACTGGGTTACTAGA
GAGCCTGGATCTTTTGAATGGTTTAAAGGAGTCATGGATGAAGTTGCAGAGATGGATCACAAA
GGTCAAATCGAACTGCACAACTACCTTACAAGCGTTTACGAAGAAGGTGATGCAAGG
TCAACTTTGATCACCATGGTCCAAGCTCTCAATCATGCGAAACATGGTGTTGACATCGTGTCAGGCACTCGA
GTGAGGACACACTTTGCAAGACCAAATTGGAAAGAAGTGTTCAACAAA
ATTGCTTCAAAGCATCCGTTTGGCACAGTAG
GGGTGTTCTATTGCGGGATGCCAGTGTTGGCAAAGGAGCTGAAGAAGCTATGCCAGGAGCTGAGTCACAAGACAACCACAAGGTTTGAG
TTTCACAAGGAGTATTTCTGA

Retrieve as FASTA