Entry information : PtRboh09(POPTR_0006s13950 / Potri.006G137300)
Entry ID 6080
Creation 2008-01-28 (Christophe Dunand)
Last sequence changes 2008-01-28 (Catherine )
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2020-04-22 (Catherine )
Peroxidase information: PtRboh09(POPTR_0006s13950 / Potri.006G137300)
Name PtRboh09(POPTR_0006s13950 / Potri.006G137300)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtRboh09
start..stop
S start..stop
DgloRboh05 1466 0 4..926 5..927
VvRboh07 1461 0 10..926 8..917
DtriRboh04 1456 0 4..926 3..950
AgluRboh05 1444 0 3..926 27..946
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11398424..11399024 601 N° 2 11399119..11399278 160 N° 3 11399576..11399624 49 N° 4 11400096..11400209 114
N° 5 11400794..11401216 423 N° 6 11401459..11401842 384 N° 7 11401920..11402015 96 N° 8 11402112..11402227 116
N° 9 11402326..11402496 171 N° 10 11402587..11402746 160 N° 11 11402840..11403028 189 N° 12 11403146..11403274 129
N° 13 11403436..11403514 79 N° 14 11403667..11403776 110  
join(11398424..11399024,11399119..11399278,11399576..11399624,11400096..11400209 ,11400794..11401216,11401459..11401842,11401920..11402015,11402112..11402227,114 02326..11402496,11402587..11402746,11402840..11403028,11403146..11403274,1140343 6..11403514,11403667..11403776)


exon

Literature and cross-references PtRboh09(POPTR_0006s13950 / Potri.006G137300)
DNA ref. Phytozome 12:   Chr6 (11398424..11403776)
Cluster/Prediction ref. Genebank:   18100289
Omic ref. ePlant:   Potri.006G137300
Protein sequence: PtRboh09(POPTR_0006s13950 / Potri.006G137300)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   926
PWM (Da):   %s   105212.12 Transmb domain:   %s   o364-386i499-521o548-570i727-744o
PI (pH):   %s   9.66
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKSTSSFGRTSSRLSNYSRTFDLPDDDLDGSETASDCEIGGAMLPIFLNDLRRNNQDELVEVTLELEKDSIVVCSVNPNGRGMSTPSTPGGGAAAGILERSLSATSRIRRKFGWLRSRSSRTTWSENEERVISARDARKLKAKLDRSKLSAQRGLKGLRFINKTTGTTSESNELWKRVESRFKLLSKDGLLAREDFGECIGMVNSKEFAVCIFDALARRKRQRITKISKEELHDFWLQISDQSFDARLQIFFDMADSNEDGRIIREEVQLIMLSASANKLSKLKEQAEEYASLIMEELDPENLGYIELWQLETLLLQRDTYMNYSRPLSTASVSWSQNISSIKPRNVMHRLSFKLRNLILEKWQRAWILSLWVMIMVGLFVWKFLQYKNKAAFHVMGYCLASAKGAAETLKFNMALILLPVCRNTLTWLRSTRARSFVPFDENINFHKMVAGAIVIGVILHAGNHLLCDFPRLINSSPENFALIASDFNNKKPTYKELVTGIEGVTGISMVVLLTIAFTLATGRFRRNGVRLPAPFNKLTGFNAFWYSHHLTGVVYILLLVHGTFLFLAHKWYQKTTWMYISAPLLLYMVERNVRTRRSEHYSVKLLKVSVLPGNVLSLILSKPQGFKYKSGQYIFLQCPAISSFEWHPFSITSAPGDDYLSVHIRIVGDWTEELKRVFTEENDSPSVIGRAKFGQLGHMDQTRQPKLYVDGPYGAPAQDYRNYDVLLLVGLGIGATPFISILRDLLNNTRTADNQDSNTENSRSDDSSNSYASSSMTPVSKKRTQRTTNAHFYWVTREPGSFEWFKGVMDEVAEMDHKGQIELHNYLTSVYEEGDARSTLITMVQALNHAKHGVDIVSGTRVRTHFARPNWKEVFNKIASKHPFGTVGVFYCGMPVLAKELKKLCQELSHKTTTRFEFHKEYF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6, 13 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAATCAACTTCGTCGTTTGGGAGGACGAGCTCCAGGCTATCCAATTACAGCCGCACGTTTGACTTACCAGACGATGATCTCGACGGTTCAGAAACCGCCAGCGACTGCGAGATTGGC
GGTGCAATGTTGCCGATTTTCTTGAACGACCTGAGAAGAAACAACCAAGATGAGTTAGTTGAGGTCACGCTCGAGCTCGAGAAAGACTCCATTGTTGTTTGCAGTGTTAATCCGAACGGT
AGAGGTATGTCAACTCCGAGTACGCCTGGCGGTGGTGCTGCGGCGGGGATTTTAGAGAGGAGTTTGTCGGCAACGTCGAGGATTAGACGGAAGTTCGGGTGGTTAAGATCAAGATCTTCG
AGAACGACATGGTCGGAGAATGAAGAGAGAGTAATCTCGGCGAGAGATGCACGGAAATTGAAAGCCAAGCTTGACAGGTCAAAACTGAGCGCTCAAAGAGGACTGAAAGGGTTGAGGTTT
ATAAATAAGACAACCGGTACGACGTCTGAGTCGAATGAGCTGTGGAAACGAGTCGAGTCCAGGTTCAAGTTGCTTTCTAAAGACGGTTTGCTTGCTAGAGAAGATTTTGGTGAATGTATA
G
GTAAATAGTTACTCAATAATAATCACTGGTTAAAAATAAATAATTTTATGTTTGTTGTTGGGTTTCTGACATGGTGTGTGAGCTATTGTGTTAGGGATGGTGAATTCGAAGGAGTTTGC
GGTGTGTATATTTGATGCACTAGCGAGGAGGAAGAGGCAGAGAATAACGAAAATAAGCAAAGAAGAGCTTCATGATTTCTGGTTACAGATTTCTGACCAGAGTTTTGACGCGCGCCTTCA
AATTTTCTTTGACAT
GTGCGTCTCTCTCTCTCTCATTTTTTTCACCCTCGAATGTTTTGAAAATCATAGTAGCAATTGGGATTTGACGATCTTTAAGTTCTACGTACAAACTCAACGGTG
GTGTTTCAGACTGTAGCATAAATCTCAGGTGGTAAGCATGCATGACCACCGTCGTCTCGATCTGCCTATATTTTTCGGGCGTTTGATCAGTACTTCTCAGACAAGTTCCAGGGCTCTTTA
ATTAATCTGCTGATAGTCTGGTTTTAATTCCAATCGGAAAACGAGAAACCTGAAACTTCTGGTGCATTGCAGGGCAGATAGCAATGAAGACGGAAGGATCATAAGAGAAGAAGTGCAGGA
G
GTAATAATATTTTCAGTAGTATAATATTATTCTCCCAAAAGATTCCTAAATAATATTACACTACTGACTGAGATGCACAATACCAACTATGATAGAGTTGCTATTCGAAGAAATAATTC
AATTAGATTTATTATTTTCGGGTGAAAAACATTAATAATTGTTTATTCCTGAGTTGTTGTTTCGCACGCATTCACCGGTTTTAGAAAGTGGTATTATTTCTTAATTCTTTTAGCATTAAA
ATATATAGGTTTCTCACAAATTAAGCAAATTAATCGGAGACATGTTTTACAACTGTGTTAACTACCATCAATCAAATCAAAGTATTTGTCAAGAAGCATATTTACATGACAACACCCTAC
ATTTCTTTTTTTTTAATTTATTATTATAAAGTAGTTAGTTATATGCACATCATGAGCAACCGATGCCAGATAATATTTTAACTGTGACATTATTACTTTCTTTTAATCCCAGCTTATAAT
GCTCAGTGCTTCTGCAAATAAACTGTCAAAGTTGAAAGAACAAGCAGAAGAATATGCTTCGTTGATAATGGAAGAACTTGATCCTGAAAACCTCGGATACATTGAG
GTAAATCACAAATT
CAACCTTCAAATGATGATCAAGCTGATTGTTTACCTCAGTTCCAGCTTTTTGAATAGGTTAATAGTCGGTTTATTTGTGTTTTTGATATTTTTTTGTTTTAAATTAATTTTTTTAACGTT
CTTATATTGTTTTGGTATGTTAATATAAAAATAATTTTTTAAAAAAATATTATTTTAATATAATTTCAAACAAAAAATAATTTAAAAAATAACTATTAATATAATATCAAATAAAATTAA
TAAATTATTTTTAATTTAGCCTACCTTACATTCAGCCCGAGGACTCCTCGGGCCTCGTCATGAAAACCACAAATCATGTAGTGGATGCCACAAATCACTGAATTTACTATATTTCTTTCT
TTTATTGGTTTCATGATTTATTATAAATTTATGATTCATGTACTTGTATTTAATATTCAGTAATAAAGTCACCGGAAGATTCATGACTAAAAAAAGTAACGGGAAGTTTTCTTGACTTTT
TCAGTCCTCCAACTTACAATTGGGCTTAGTCTTTTCATTTAAAAAAAAAAAAAAGATTTAAGAGAAAAAAGAGTTATTTCCCATTTTCAGTTATGGCAGTTAGAGACACTTCTTCTACAA
AGGGACACATACATGAACTACAGCAGACCATTGAGTACAGCAAGTGTAAGCTGGAGTCAGAACATAAGTTCAATCAAACCCCGGAACGTGATGCATAGGCTAAGCTTTAAATTGAGGAAT
TTAATTCTAGAGAAATGGCAAAGGGCATGGATTTTATCGCTGTGGGTGATGATAATGGTTGGCCTATTCGTCTGGAAATTCCTTCAATACAAGAACAAGGCTGCATTTCACGTCATGGGC
TATTGCTTGGCGAGTGCCAAAGGTGCTGCAGAGACTCTCAAATTCAACATGGCTCTAATTCTATTACCTGTTTGTCGAAACACACTGACTTGGCTTCGGTCCACTCGAGCAAGGTCATTT
GTTCCTTTTGATGAAAATATTAATTTCCACAAG
GTAAGAAGGCTTACTATGCTAATTATATATAATTGACAAAGGATTTGGACAGGTTAATTAATAGATAAAAAGAAATCAAATTCATAT
ACGATTTGCCTTTGCTTAAGGTTCTGTTCATAATTAATGATGGAGCAACAATCCGAGATTCTACAAGCCAAACAAATGAAAGAAGTGAATATTTAATAGAAACATGCTAAAAACATCGTC
AGTCCCTGACCCCCTCTTTTACCTTATTTTCCCAGATGGTTGCAGGCGCTATAGTAATTGGAGTCATCTTGCATGCAGGAAACCATCTATTATGTGACTTTCCCCGTCTGATAAACTCGT
CTCCTGAAAATTTTGCCTTGATTGCGTCTGATTTCAATAATAAAAAGCCTACATATAAAGAACTTGTGACTGGTATTGAAGGCGTGACTGGGATTTCTATGGTGGTGTTATTGACCATTG
CATTCACTCTGGCAACAGGCCGCTTCCGGAGAAATGGGGTGAGACTACCTGCACCCTTCAACAAATTGACAGGTTTCAATGCGTTCTGGTACTCTCATCATCTTACTGGTGTGGTCTATA
TTCTGCTGCTCGTCCATGGAACCTTCTTGTTCTTAGCCCACAAGTGGTATCAGAAAACA
GTAAGAACTTTCGAAGCTTTTGTGACAAGATAATCAATAATTAGCAAGTAACATCTGTTAT
TTTTCTGATTTTCCAGACGTGGATGTATATCTCTGCTCCCTTGCTGCTCTACATGGTTGAACGAAATGTGAGAACACGTAGATCAGAACATTATTCTGTAAAATTATTGAAGGTAATTAG
TCAAGTTCTTGGAGGCTTTAGCGCTGCTTTCTAGATGATCTCTTGTTTTTCTTGGCAAGAAGAGTCTAACATGACCTGATTCGGATAGGTGTCAGTGCTACCGGGAAATGTCCTCAGCTT
AATCTTGTCCAAGCCACAGGGATTTAAGTACAAAAGTGGGCAGTACATTTTTCTACAATGCCCAGCAATTTCCTCCTTTGAATG
GTAGTGTTTCTGAAAATAACAACTCCTGTTAATTAC
AATAATTATTATTATTATGAAATATGATCATGTTTCAAAGAAATGAACCTAGTCCCTTTCAGGCACCCATTCTCTATAACCTCAGCACCAGGGGATGACTATCTCAGTGTTCACATCCGG
ATAGTCGGAGACTGGACGGAGGAATTGAAGCGAGTTTTCACCGAGGAAAATGATTCACCATCTGTTATTGGTCGTGCCAAATTTGGTCAACTTGGGCACATGGATCAAACAAG
GTTATTT
AAACACTGAGCAACTCCACTGTATTAGACTTGCATTCAAACAATTTGTGAAAATATTGAGGCAAAATGCCTGCATTGCTGCAGACAACCAAAGCTGTATGTTGATGGTCCATATGGGGCT
CCAGCACAAGACTACAGAAATTACGATGTCTTGCTTCTCGTGGGGCTTGGCATAGGAGCTACCCCTTTCATAAGCATCCTTAGAGATCTTTTGAATAATACACGAACAGCAGATAATCAA
ATG
GTAAATGTCATTCCCTGAGATTTCATCTGTGCATATTATACTATTATAAAGTGAAGATTTACATCCAGCAATTGATTTTCTATGTTTTACTAGGATTCAAACACTGAAAACAGTCGG
TCAGATGACAGTTCAAATAGTTATGCATCTTCAAGTATGACACCAGTTAGCAAGAAGAGAACACAGAGGACTACCAATGCTCATTTCTACTGGGTTACTAGAGAGCCTGGATCTTTTGAA
TGGTTTAAAGGAGTCATGGATGAAGTTGCAGAGATGGATCACAAA
GTAAGACAAAAACTTCCAACCCATGTTTCATTATCCATGTCTCAAATAAATTGCCACGGCTATCATTACAAAGTG
ATAGGTATTAACCTTCCCTCTTCTTATATAACAACAAAATAGGGTCAAATCGAACTGCACAACTACCTTACAAGCGTTTACGAAGAAGGTGATGCAAGGTCAACTTTGATCACCATGGTC
CAAGCTCTCAATCATGCGAAACATGGTGTTGACATCGTGTCAGGCACTCGA
GTATGTTCCCTGATAAATATAAAGTTTTAGGTTGTCAAAATTACTGTAGACAACAAGGTCAACCCGCCA
ATCAATAACTGGTGGGAGCTGGGAAATCAAATATTCAAAGCACCGCAGGGGTGAAGAAAACTTATTCATCATTTGGCTCTATTTTGTTGCAGGTGAGGACACACTTTGCAAGACCAAATT
GGAAAGAAGTGTTCAACAAAATTGCTTCAAAGCATCCGTTTGGCACAGTAG
GTAAGGAAAGCATACAAATTAATAAAACACCATTTTCATGTAATGACCAGATTACGGTTGAAAATACAA
GGCATCGATCTTCTGCAATCTTTTGGTAATAGACAAGTATTATAATTTTTTACTAAAAAACAGCTTGTTAAATTACAATGCAGGGGTGTTCTATTGCGGGATGCCAGTGTTGGCAAAGGA
GCTGAAGAAGCTATGCCAGGAGCTGAGTCACAAGACAACCACAAGGTTTGAGTTTCACAAGGAGTATTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAATCAACTTCGTCGTTTGGGAGGACGAGCTCCAGGCTATCCAATTACAGCCGCACGTTTGACTTACCAGACGATGATCTCGACGGTTCAGAAACCGCCAGCGACTGCGAGATTGGC
GGTGCAATGTTGCCGATTTTCTTGAACGACCTGAGAAGAAACAACCAAGATGAGTTAGTTGAGGTCACGCTCGAGCTCGAGAAAGACTCCATTGTTGTTTGCAGTGTTAATCCGAACGGT
AGAGGTATGTCAACTCCGAGTACGCCTGGCGGTGGTGCTGCGGCGGGGATTTTAGAGAGGAGTTTGTCGGCAACGTCGAGGATTAGACGGAAGTTCGGGTGGTTAAGATCAAGATCTTCG
AGAACGACATGGTCGGAGAATGAAGAGAGAGTAATCTCGGCGAGAGATGCACGGAAATTGAAAGCCAAGCTTGACAGGTCAAAACTGAGCGCTCAAAGAGGACTGAAAGGGTTGAGGTTT
ATAAATAAGACAACCGGTACGACGTCTGAGTCGAATGAGCTGTGGAAACGAGTCGAGTCCAGGTTCAAGTTGCTTTCTAAAGACGGTTTGCTTGCTAGAGAAGATTTTGGTGAATGTATA
G
GGATGGTGAATTCGAAGGAGTTTGCGGTGTGTATATTTGATGCACTAGCGAGGAGGAAGAGGCAGAGAATAACGAAAATAAGCAAAGAAGAGCTTCATGATTTCTGGTTACAGATTTCT
GACCAGAGTTTTGACGCGCGCCTTCAAATTTTCTTTGACAT
GGCAGATAGCAATGAAGACGGAAGGATCATAAGAGAAGAAGTGCAGGAGCTTATAATGCTCAGTGCTTCTGCAAATAAA
CTGTCAAAGTTGAAAGAACAAGCAGAAGAATATGCTTCGTTGATAATGGAAGAACTTGATCCTGAAAACCTCGGATACATTGAG
TTATGGCAGTTAGAGACACTTCTTCTACAAAGGGAC
ACATACATGAACTACAGCAGACCATTGAGTACAGCAAGTGTAAGCTGGAGTCAGAACATAAGTTCAATCAAACCCCGGAACGTGATGCATAGGCTAAGCTTTAAATTGAGGAATTTAATT
CTAGAGAAATGGCAAAGGGCATGGATTTTATCGCTGTGGGTGATGATAATGGTTGGCCTATTCGTCTGGAAATTCCTTCAATACAAGAACAAGGCTGCATTTCACGTCATGGGCTATTGC
TTGGCGAGTGCCAAAGGTGCTGCAGAGACTCTCAAATTCAACATGGCTCTAATTCTATTACCTGTTTGTCGAAACACACTGACTTGGCTTCGGTCCACTCGAGCAAGGTCATTTGTTCCT
TTTGATGAAAATATTAATTTCCACAAG
ATGGTTGCAGGCGCTATAGTAATTGGAGTCATCTTGCATGCAGGAAACCATCTATTATGTGACTTTCCCCGTCTGATAAACTCGTCTCCTGAA
AATTTTGCCTTGATTGCGTCTGATTTCAATAATAAAAAGCCTACATATAAAGAACTTGTGACTGGTATTGAAGGCGTGACTGGGATTTCTATGGTGGTGTTATTGACCATTGCATTCACT
CTGGCAACAGGCCGCTTCCGGAGAAATGGGGTGAGACTACCTGCACCCTTCAACAAATTGACAGGTTTCAATGCGTTCTGGTACTCTCATCATCTTACTGGTGTGGTCTATATTCTGCTG
CTCGTCCATGGAACCTTCTTGTTCTTAGCCCACAAGTGGTATCAGAAAACA
ACGTGGATGTATATCTCTGCTCCCTTGCTGCTCTACATGGTTGAACGAAATGTGAGAACACGTAGATCA
GAACATTATTCTGTAAAATTATTGAAG
GTGTCAGTGCTACCGGGAAATGTCCTCAGCTTAATCTTGTCCAAGCCACAGGGATTTAAGTACAAAAGTGGGCAGTACATTTTTCTACAATGC
CCAGCAATTTCCTCCTTTGAATG
GCACCCATTCTCTATAACCTCAGCACCAGGGGATGACTATCTCAGTGTTCACATCCGGATAGTCGGAGACTGGACGGAGGAATTGAAGCGAGTTTTC
ACCGAGGAAAATGATTCACCATCTGTTATTGGTCGTGCCAAATTTGGTCAACTTGGGCACATGGATCAAACAAG
ACAACCAAAGCTGTATGTTGATGGTCCATATGGGGCTCCAGCACAA
GACTACAGAAATTACGATGTCTTGCTTCTCGTGGGGCTTGGCATAGGAGCTACCCCTTTCATAAGCATCCTTAGAGATCTTTTGAATAATACACGAACAGCAGATAATCAAATG
GATTCA
AACACTGAAAACAGTCGGTCAGATGACAGTTCAAATAGTTATGCATCTTCAAGTATGACACCAGTTAGCAAGAAGAGAACACAGAGGACTACCAATGCTCATTTCTACTGGGTTACTAGA
GAGCCTGGATCTTTTGAATGGTTTAAAGGAGTCATGGATGAAGTTGCAGAGATGGATCACAAA
GGTCAAATCGAACTGCACAACTACCTTACAAGCGTTTACGAAGAAGGTGATGCAAGG
TCAACTTTGATCACCATGGTCCAAGCTCTCAATCATGCGAAACATGGTGTTGACATCGTGTCAGGCACTCGA
GTGAGGACACACTTTGCAAGACCAAATTGGAAAGAAGTGTTCAACAAA
ATTGCTTCAAAGCATCCGTTTGGCACAGTAG
GGGTGTTCTATTGCGGGATGCCAGTGTTGGCAAAGGAGCTGAAGAAGCTATGCCAGGAGCTGAGTCACAAGACAACCACAAGGTTTGAG
TTTCACAAGGAGTATTTCTGA

Retrieve as FASTA