Entry information : PpaRboh03-1
Entry ID 6087
Creation 2008-01-29 (Christophe Dunand)
Last sequence changes 2008-01-29 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2012-04-19 (Catherine Mathe)
Peroxidase information: PpaRboh03-1
Name PpaRboh03-1
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaRboh03-1
start..stop
S start..stop
PpaRboh03-3 1300 0 2..775 119..886
PpaRboh03-2 1188 0 1..775 45..827
PpaRboh03-4 1161 0 1..775 34..800
MpRboh02 1037 0 5..775 221..1023
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 364491..364665 175 N° 2 364788..364947 160 N° 3 365068..365230 163 N° 4 365330..365737 408
N° 5 365850..366329 480 N° 6 366442..366734 293 N° 7 366844..367012 169 N° 8 367126..367287 162
N° 9 367419..367547 129 N° 10 367674..367752 79 N° 11 367877..367986 110  
join(364491..364665,364788..364947,365068..365230,365330..365737,365850..366329, 366442..366734,366844..367012,367126..367287,367419..367547,367674..367752,36787 7..367986)


exon

Literature and cross-references PpaRboh03-1
Literature Rensing,S., et al., The genome of the moss Physcomitrella patens reveals evolutionary insights into the conquest of land by plants. Science (2008) In press
DNA ref. Phytozome 11:   scaffold_32 (364491..367986)
Cluster/Prediction ref. UniGene:   Ppa.5533 [3' end]
Protein sequence: PpaRboh03-1
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   775
PWM (Da):   %s   88250.46 Transmb domain:   %s   o220-239i356-378o393-415i420-442o
PI (pH):   %s   9.38
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQKSTSSRAEYAIKGLRYINKATATADQKKSWEQVEARFHKLANLENMLHRSDFAECIGMKDSKEFANELFDALVRRQGVEVESIGKDELYLHWLQIADKSFDARMQLFFDLCDKDLDGRITGEEVKQLIMLSASANKLSKLKDQAAEYAALIMEGLHVDGAEYILSQLKTLMSGSVQGFGRETTVNNNQTLTPKSKRSRMMGVAEKSAYFLLDNCKRIWILALWISVMVGLFAWKFLQYRNRSAWWVMGDCLCVAKGAAETLKLNMALILLPVCRNTITRLRSTRLRRIIPFDDNLDFHKIVAGGIAAGVILHATCHITCDIPRFVEADKEKFFKYLGDDFDFQPTYSDILRMSVGYSGLIMVVLMILAFLLATHWFRQSLVKLPWPFHRLTGFNAFWYSHHLFAIVYAFLLLHGSKLLLPNSILERSTWIYIAVPLVLYAGERFLRMYRTNSSKVDVIKAAIYTGNVLAIHMSKPEGFKYKSGMYLFLQCPEISSFEWHPFSITSAPEDPFLSVHIRTLGDWTAELKRIFSDACGGRMRLQTVNNYGLSGELTLAARFPKLYIDGPYGAPAQDYLNYDVLLLVGLGIGATPFISILKDLLHHTINESLGHSDSLTPDLRPMESPRTRSKKKAKRNPKAYFYWMTREQGSFDWFRGVMREVEEIDHKGSIEMHNYLTSVYEEGDARSTLVIMLQALHHAKNGVDLVSGTRARTHFARPNWKSVFSKLAATHQEKRIGVFYCGPVTLANELENLSRTYTQKSSTKFSFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (10 introns), and 4 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGAAGAGTACATCTTCTCGCGCAGAATATGCAATTAAGGGACTACGATATATCAACAAGGCTACCGCCACAGCTGACCAAAAGAAGTCGTGGGAGCAAGTAGAGGCGCGGTTTCAC
AAACTCGCCAACTTAGAAAATATGCTGCACCGCTCAGATTTTGCCGAATGTATCG
GTGCGTGCCACTGGTTGCCTGTTTCGGCCACCTTCTGTTAATGGAGAAAACTAAAATAAGCCATA
AGAAAAGCAGTACAGCTCCAGGTCTTGAAGTGACAAGGGTCGTGGTTTTGTGCACAGGGATGAAAGACTCCAAAGAGTTCGCAAATGAGCTTTTCGATGCACTGGTGCGTCGGCAAGGGG
TTGAAGTGGAAAGCATTGGTAAAGATGAGTTGTACCTGCATTGGCTGCAGATTGCCGATAAAAGCTTCGACGCCCGGATGCAATTGTTCTTTGACTT
GTAATTGAATTCTCCACTTTGGA
CTCTGCAACTGCCAGTTCTGGAGACAAGGTAGTCCCCTATGATCGCAATGCTGTCTGGAATAAGCTGAAGTACTCAACGTTTCATTTTCGCTTGCAGGTGTGACAAGGATTTGGATGGTC
GTATCACAGGCGAGGAAGTGAAGCAGTTAATAATGTTGAGCGCAAGTGCAAATAAGCTGTCCAAATTAAAGGATCAGGCTGCTGAGTATGCCGCCTTGATTATGGAAGGACTTCATGTAG
ATGGAGCTGAGTATATAACG
GTAACTACTTGCGACTTCCTCTCAGCAAATCTAAGGATTTTAAGATGGTTGAGGTGTGACGGGATCGGGTACTAATGAAATAGAGTTGGATGGTTGCAGC
TGAGCCAATTGAAGACTTTGATGAGCGGATCGGTACAGGGGTTTGGGAGGGAGACGACTGTGAACAACAATCAAACGTTGACACCAAAGAGCAAGCGGTCTAGGATGATGGGAGTTGCGG
AGAAGTCTGCTTACTTCTTGCTGGACAATTGTAAACGAATTTGGATACTAGCCCTCTGGATATCGGTCATGGTGGGACTCTTCGCATGGAAATTTCTCCAGTATAGGAATCGTAGTGCAT
GGTGGGTAATGGGTGACTGCCTCTGCGTGGCGAAAGGTGCTGCAGAGACATTGAAGCTGAATATGGCGCTAATACTCCTCCCCGTCTGCCGCAACACAATCACAAGGCTGCGGTCCACTC
GACTAAGAAGGATCATCCCCTTCGACGACAATCTTGATTTTCACAAG
GTTAGTCACGTCTTCATTTTTGGTTTAACTTTCTCGTGTCTGATCTTGACAATATGTATGAAAACAAGAGTGT
GCCTTGATCTGATATAGCGTGCAAATTTGGTATGTGCAGATTGTAGCTGGAGGTATAGCGGCGGGAGTGATTCTCCACGCTACTTGCCACATAACCTGCGATATACCTAGGTTTGTCGAA
GCGGATAAAGAAAAGTTTTTCAAGTATCTGGGTGACGATTTTGATTTCCAACCTACTTATTCTGACATACTCAGAATGTCAGTGGGATACAGTGGCTTGATCATGGTTGTGCTCATGATT
CTCGCCTTCTTGCTTGCCACTCACTGGTTCCGTCAGAGTCTGGTCAAGTTGCCATGGCCATTCCACCGGCTCACGGGGTTCAATGCGTTCTGGTACTCGCACCACCTTTTCGCCATCGTT
TACGCCTTCCTCCTCCTCCACGGATCCAAGCTCCTTCTCCCAAATTCGATTCTCGAACGCTCAACATGGATATACATTGCAGTGCCCTTGGTTCTATATGCGGGCGAACGGTTCTTGCGC
ATGTATCGTACAAATTCCAGCAAGGTGGATGTTATCAAG
GTGAGGGTTGCCATTTCTGGCTGTTCTCGATAAAAAGAAAAAATTTCTGTTTCTTTTCAATGGTAGTATCACCTTAAGATG
TGGCATTAATCAGTCCTTGCCATGTGAGCAGGCTGCGATTTACACTGGCAACGTCCTCGCCATCCATATGTCCAAACCAGAAGGCTTCAAGTATAAGAGCGGCATGTACTTGTTCTTGCA
ATGCCCTGAAATCTCCTCGTTCGAATGGCATCCATTCTCTATCACTTCTGCCCCCGAGGATCCCTTCCTGAGTGTTCACATTCGTACACTGGGAGACTGGACTGCCGAGTTGAAGAGGAT
TTTCTCAGATGCCTGTGGTGGACGAATGCGCCTGCAAACTGTGAACAATTATGGACTTAGTGGTGAATTGACACTAGCTGCAAG
GTACTCCTCCATCATCATTTCATTGAATATCACACC
AGCCCTTAAAATGTCAAGAACCTTGGTGATGGTGGGACTCGGTCATCTGACCCAGCAGCTTTGATGTTTACAGATTTCCGAAGCTGTACATCGATGGTCCTTACGGTGCCCCTGCGCAAG
ACTATCTCAATTACGACGTGCTACTTCTTGTTGGACTAGGAATAGGAGCGACGCCATTCATCAGCATCCTCAAGGATTTGCTTCATCACACCATAAATGAGTCACTGGGACATTCTGATC
CG
GTACGTGATCCTGGTTCCGCGTCGTTGAATTTTCTTATCTGAGAGCCGTGATCGATTCCTCTATTTTCTCAGAAGGAATATTGATTGGCTAAAAATTCACCTCATGATTCCAGAGCTT
AACTCCTGATTTGCGCCCAATGGAAAGTCCGAGGACGAGAAGCAAGAAGAAAGCTAAGAGAAACCCCAAGGCATACTTTTATTGGATGACCAGAGAGCAAGGCTCCTTCGACTGGTTCAG
AGGAGTCATGCGAGAAGTCGAAGAGATTGATCACAAG
GTGATCTCTACTTTCATACTTCCAATGATAGAAAACTCCCATATTTTAATCGGCTCGGGCTTCAATCTTCAGTTGGCCTGAGA
TGAAACCTATTGTTACTCATTGTAGTGTTGGGTCCATGGAGTTTGCAGGGGTCCATTGAGATGCACAACTATTTGACCAGTGTGTACGAGGAAGGTGATGCTCGGTCGACGTTGGTCATA
ATGTTACAAGCCTTGCATCACGCGAAAAATGGGGTCGATCTAGTTTCAGGCACTCGG
GTATGTGTTAATTCCATCCTCCATCTTTGAAATCCTATTTTTTAAACTTGTACCCTCCAGTTT
TGTAGCATCTATAATGCGTGCCTTTTGCAAGTTTTATTGCACTAACCTTCTGATTCTTTGCAGGCTCGTACACATTTTGCAAGACCGAACTGGAAGAGTGTTTTCTCAAAGCTGGCAGCT
ACACACCAGGAAAAGCGCATCG
GTACAACTCTCCAAATCATCTTGTCACAGTTGCTTCTGACACCCCTACCCTTCTTTTGAATCAGCCTACATGTCACATGCAATGTATCAAAGCTTATT
ATTGTATATGTTTGTGTGTATTTCAGGAGTGTTTTATTGCGGTCCTGTAACTCTTGCGAACGAGCTTGAGAACCTTTCAAGAACATACACACAGAAGTCTTCCACAAAATTCTCCTTTCA
CAAGGAGAATTTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGAAGAGTACATCTTCTCGCGCAGAATATGCAATTAAGGGACTACGATATATCAACAAGGCTACCGCCACAGCTGACCAAAAGAAGTCGTGGGAGCAAGTAGAGGCGCGGTTTCAC
AAACTCGCCAACTTAGAAAATATGCTGCACCGCTCAGATTTTGCCGAATGTATCG
GGATGAAAGACTCCAAAGAGTTCGCAAATGAGCTTTTCGATGCACTGGTGCGTCGGCAAGGGGTT
GAAGTGGAAAGCATTGGTAAAGATGAGTTGTACCTGCATTGGCTGCAGATTGCCGATAAAAGCTTCGACGCCCGGATGCAATTGTTCTTTGACTT
GTGTGACAAGGATTTGGATGGTCGT
ATCACAGGCGAGGAAGTGAAGCAGTTAATAATGTTGAGCGCAAGTGCAAATAAGCTGTCCAAATTAAAGGATCAGGCTGCTGAGTATGCCGCCTTGATTATGGAAGGACTTCATGTAGAT
GGAGCTGAGTATATAACG
CTGAGCCAATTGAAGACTTTGATGAGCGGATCGGTACAGGGGTTTGGGAGGGAGACGACTGTGAACAACAATCAAACGTTGACACCAAAGAGCAAGCGGTCT
AGGATGATGGGAGTTGCGGAGAAGTCTGCTTACTTCTTGCTGGACAATTGTAAACGAATTTGGATACTAGCCCTCTGGATATCGGTCATGGTGGGACTCTTCGCATGGAAATTTCTCCAG
TATAGGAATCGTAGTGCATGGTGGGTAATGGGTGACTGCCTCTGCGTGGCGAAAGGTGCTGCAGAGACATTGAAGCTGAATATGGCGCTAATACTCCTCCCCGTCTGCCGCAACACAATC
ACAAGGCTGCGGTCCACTCGACTAAGAAGGATCATCCCCTTCGACGACAATCTTGATTTTCACAAG
ATTGTAGCTGGAGGTATAGCGGCGGGAGTGATTCTCCACGCTACTTGCCACATA
ACCTGCGATATACCTAGGTTTGTCGAAGCGGATAAAGAAAAGTTTTTCAAGTATCTGGGTGACGATTTTGATTTCCAACCTACTTATTCTGACATACTCAGAATGTCAGTGGGATACAGT
GGCTTGATCATGGTTGTGCTCATGATTCTCGCCTTCTTGCTTGCCACTCACTGGTTCCGTCAGAGTCTGGTCAAGTTGCCATGGCCATTCCACCGGCTCACGGGGTTCAATGCGTTCTGG
TACTCGCACCACCTTTTCGCCATCGTTTACGCCTTCCTCCTCCTCCACGGATCCAAGCTCCTTCTCCCAAATTCGATTCTCGAACGCTCAACATGGATATACATTGCAGTGCCCTTGGTT
CTATATGCGGGCGAACGGTTCTTGCGCATGTATCGTACAAATTCCAGCAAGGTGGATGTTATCAAG
GCTGCGATTTACACTGGCAACGTCCTCGCCATCCATATGTCCAAACCAGAAGGC
TTCAAGTATAAGAGCGGCATGTACTTGTTCTTGCAATGCCCTGAAATCTCCTCGTTCGAATGGCATCCATTCTCTATCACTTCTGCCCCCGAGGATCCCTTCCTGAGTGTTCACATTCGT
ACACTGGGAGACTGGACTGCCGAGTTGAAGAGGATTTTCTCAGATGCCTGTGGTGGACGAATGCGCCTGCAAACTGTGAACAATTATGGACTTAGTGGTGAATTGACACTAGCTGCAAG
A
TTTCCGAAGCTGTACATCGATGGTCCTTACGGTGCCCCTGCGCAAGACTATCTCAATTACGACGTGCTACTTCTTGTTGGACTAGGAATAGGAGCGACGCCATTCATCAGCATCCTCAAG
GATTTGCTTCATCACACCATAAATGAGTCACTGGGACATTCTGATCCG
AGCTTAACTCCTGATTTGCGCCCAATGGAAAGTCCGAGGACGAGAAGCAAGAAGAAAGCTAAGAGAAACCCC
AAGGCATACTTTTATTGGATGACCAGAGAGCAAGGCTCCTTCGACTGGTTCAGAGGAGTCATGCGAGAAGTCGAAGAGATTGATCACAAG
GGGTCCATTGAGATGCACAACTATTTGACC
AGTGTGTACGAGGAAGGTGATGCTCGGTCGACGTTGGTCATAATGTTACAAGCCTTGCATCACGCGAAAAATGGGGTCGATCTAGTTTCAGGCACTCGG
GCTCGTACACATTTTGCAAGA
CCGAACTGGAAGAGTGTTTTCTCAAAGCTGGCAGCTACACACCAGGAAAAGCGCATCG
GAGTGTTTTATTGCGGTCCTGTAACTCTTGCGAACGAGCTTGAGAACCTTTCAAGAACATAC
ACACAGAAGTCTTCCACAAAATTCTCCTTTCACAAGGAGAATTTTTGA

Retrieve as FASTA