Entry information : PpaRboh03-2
Entry ID 6088
Creation 2008-01-30 (Christophe Dunand)
Last sequence changes 2008-01-30 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2012-04-19 (Catherine Mathe)
Peroxidase information: PpaRboh03-2
Name PpaRboh03-2
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaRboh03-2
start..stop
S start..stop
PpaRboh03-4 1297 0 14..827 3..800
PpaRboh03-3 1226 0 1..827 75..886
PpaRboh03-1 1180 0 45..827 1..775
MpRboh02 1018 0 2..827 165..1023
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 133215..133518 304 N° 2 133645..133804 160 N° 3 134008..134170 163 N° 4 134290..134704 415
N° 5 134821..135197 377 N° 6 135313..135408 96 N° 7 135516..135808 293 N° 8 135935..136138 204
N° 9 136229..136511 283 N° 10 136638..136716 79 N° 11 136837..136946 110  
join(133215..133518,133645..133804,134008..134170,134290..134704,134821..135197, 135313..135408,135516..135808,135935..136138,136229..136511,136638..136716,13683 7..136946)


exon

Literature and cross-references PpaRboh03-2
DNA ref. Phytozome 11:   scaffold_10 (133215..136946)
Protein sequence: PpaRboh03-2
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   827
PWM (Da):   %s   94809.78 Transmb domain:   %s   i264-283o395-417i436-458o473-487i625-642o
PI (pH):   %s   9.61
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVKQLSNEFHRYPRSASRVQDLDNSVDERGVLDSELGNCGSTRKMQKSTSRAEYAIKAVRCISKATATADQKKSWQKVEERFHKLRDADSMLPRFYFPECIGMKESKEFALELFDALVRRKGEKVNSISKDGLYQFWLEITDKSFDARMQMFFDLCDKDLDGRISGEEVKQVIMLSASANKLSKLKEQAAEYAALIMEELDVNRNGYILSHLETLLRESVLPGHGKEATMNNHQLLIKRSKRSRIRSFAEKTRNCFQDNWKRLWILALWMMAMTGLFIWKFFQYREHAAFPIMGNCLCVAKGAAETLKLNMALVLLPVCRNTLTRLRSTRLGKIIPFDDNLDFHKETGGIAAGVFIHGVCHITCDIPKFVESGDDKFFKYLGDEFEKHPTYANIAVMPVAITGILMVVFMIIAFLLATHWFRRSMVKLPWPLQRLTGFNAFWYSHHLFVIVYALLMVHSIKLLLAGPWYKRTWMYIAIPLLLYAGERMLRLYRTNSSKVEIVKAAIYTGNVLAIHITKPQGFKYKSGMYLFLQCPQISSFEWHPFSITSAPGDPFLSVHIRTLGDWTAEMKKIFSEACGGRTCLQTINNYGLSGELTLAARFPKLFVDGPYGAPAQDYLKYDVLLLVGLGIGATPFISILKDMLHHTRYDLSDPVMKPCDRESCRLRAPLTPSLRPTESPKKKKKSKRKPKAYFYWVTREQGSFDWFRGIMREVEEIDNKESIEMHNYLTSVYEEGDARSTLVTMLQSLYHAKNGVDLVSGTARTHFARPNWKDVFANLTFTHPEKRIGVFYCGPAALVNELETLSRTYTKESSTKFSFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (10 introns). No EST. Incorrect prediction from Phytozome (5' is missing and splicing error)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGAAACAGTTGAGCAATGAGTTCCATCGATATCCACGAAGTGCTTCCAGGGTTCAAGATTTGGACAACTCCGTGGACGAGCGGGGAGTTCTGGATTCCGAGCTCGGAAACTGTGGC
TCAACCAGGAAAATGCAAAAAAGTACTTCGCGCGCGGAATATGCAATCAAAGCTGTGCGGTGTATCAGCAAGGCCACTGCTACCGCAGACCAAAAGAAGTCGTGGCAGAAAGTAGAAGAA
CGGTTTCACAAGCTTCGTGACGCTGATTCTATGTTGCCTCGTTTCTATTTTCCCGAATGCATCG
GTGCGTTGAATGATCCGTTGCATTTCTCTCTTGTTACGAAGGACTTCAATTCAACC
AGGAACAACGGTAATGGAATGCTTTGTGTGGACATAATAAACAAGGATTGTTGCTTTGTTGTGTTCGTAGGAATGAAGGAATCCAAGGAATTTGCTCTGGAGCTCTTTGATGCGTTGGTG
CGTCGTAAAGGCGAGAAGGTGAATAGCATCAGCAAAGATGGCTTATACCAGTTTTGGTTGGAAATCACAGATAAAAGCTTCGACGCCAGGATGCAGATGTTCTTTGACCT
GTAAACTGCC
CCGACCGTTTCATGAATCTTCCCCCTAGAAAGTTCATCTAAGTCCACCCTCTTTCCGTATTTCCTGTTTCCAGAGTTGAGTGTTAGGATTGATTTGAGGATGAAGAGGTGCTTTGGCTCA
GCGTGTTCCTATTGATCATATTAGAATCTGATTTGAGTAAGCTGAATGGAAGAATTCTCGGATCCTTCGACAGGTGTGACAAGGATTTGGACGGTCGAATTTCAGGCGAGGAAGTGAAGC
AAGTGATCATGTTGAGTGCAAGTGCGAACAAGTTGTCAAAACTGAAGGAGCAGGCGGCAGAGTATGCAGCCCTTATTATGGAAGAACTTGATGTGAATCGTAATGGTTACATAGAG
GTAA
CACTTGAAGTCTTCCGCAATCACCCCCATCTGTACTCGAATTTTTAGATTCTCAACAGTAGATGTATTACATCTTTTGTAAAAGTTACAGATTAAATTGACTTTGATGTACGCAGTTGAG
TCATTTAGAGACATTGTTGCGCGAATCGGTGTTGCCGGGGCATGGAAAAGAGGCAACAATGAACAACCACCAATTGTTGATAAAGAGGAGCAAGCGATCCAGGATTCGCAGCTTCGCTGA
GAAGACGAGGAACTGCTTTCAGGATAATTGGAAACGGTTGTGGATATTGGCTCTGTGGATGATGGCCATGACAGGACTTTTCATTTGGAAGTTTTTTCAGTATCGGGAGCACGCTGCGTT
TCCAATCATGGGCAACTGTCTTTGCGTCGCCAAGGGCGCAGCTGAGACTTTGAAGCTGAACATGGCGCTCGTTCTCCTGCCCGTTTGCCGCAACACGCTCACACGGTTGAGGTCCACGCG
ATTAGGAAAGATCATTCCTTTCGACGACAATCTCGACTTTCACAAGGAAA
GTCTCTCCTGAATCAGAGTGATTAAGCTGGAATCGATCGCTAGGTGGTGAAGCCGTGAGAGAAATTTGTT
GAGGCATCTGACAGGGATTGCAAAAGTGGTTTTACGCAGATCATAGCCGGAGGTATAGCAGCCGGGGTGTTCATTCATGGTGTTTGTCACATAACCTGCGACATTCCCAAATTCGTCGAA
AGTGGCGATGATAAATTCTTCAAGTACCTCGGCGACGAATTCGAAAAGCACCCAACCTACGCTAACATTGCAGTGATGCCAGTGGCGATCACGGGTATTCTCATGGTGGTTTTCATGATA
ATTGCCTTCTTACTAGCCACTCACTGGTTCCGTCGCAGCATGGTGAAGCTTCCGTGGCCATTGCAGCGTCTGACGGGATTCAATGCATTCTGGTATTCACATCACCTGTTCGTGATTGTA
TACGCACTCCTCATGGTCCACTCCATCAAGCTACTTCTTGCTGGTCCATGGTACAAGCGAACG
GTATGGGTTCTTCTTACGCCAATCCAAACCGATGTCGCTCAAATTGCATATGGAGTT
CAAAACTTGCGAATGTGTCAACGTTCGTGTCTGAGCTTCGAGGTGTGTGTGGGTGCAGACATGGATGTACATCGCTATCCCCTTACTTTTATACGCAGGCGAACGGATGCTGCGATTGTA
CCGCACCAACTCCAGCAAAGTGGAGATCGTGAAG
GTGGGGATTCATCTTCCACTGTGTTCTGTGCAAGTGGATCTAATGACTTGGCAATTTCTGATACTTCCATTCAGAAGTAGAATTGA
CATCGCTCCTGGTCGAAGCAGGCTGCAATTTACACCGGTAACGTCCTTGCTATCCACATCACAAAACCCCAGGGCTTCAAGTACAAGAGCGGCATGTACCTCTTCTTGCAGTGCCCCCAA
ATCTCCTCTTTTGAATGGCACCCATTCTCCATAACGTCTGCCCCCGGTGACCCTTTCCTCAGTGTTCACATCCGCACACTGGGTGACTGGACTGCGGAGATGAAGAAAATCTTCTCTGAG
GCTTGCGGTGGACGAACGTGCCTTCAAACTATCAACAATTATGGCCTCAGTGGTGAGCTGACTCTAGCTGCAAG
GTACTAAATGATCACCACGGTATTGGACTTCACCAAAAAGACCTTA
GAATGCTTTGGTATGACTCAATAATAGAGCGTAGTATACTTTCAAGCGCTTGTCTCACCAATTGTTGTGTGTGTCTGCAGATTCCCAAAGTTGTTCGTCGATGGTCCGTATGGAGCTCCC
GCTCAAGACTACCTGAAATATGATGTGCTGCTCCTGGTTGGACTCGGAATTGGAGCAACGCCATTTATTAGTATCCTCAAGGACATGCTTCATCACACCAGATATGACCTTTCTGATCCG
GTAATGAAACCATGTGATCGTGAATCATGTCGTTTGAGAGCTCC
GTTTGCTTCCCCTAGCATTTTGCTTCGAGTAATGGTTCCTTATAACACTGCTTTATTTATATTCAAATCATTCATT
TTCTGTTTGCAGAGCTTAACACCAAGTTTACGCCCAACCGAAAGTCCAAAGAAAAAGAAGAAAAGCAAGAGGAAACCGAAAGCTTACTTCTACTGGGTCACACGAGAGCAAGGCTCCTTC
GACTGGTTCAGAGGAATCATGCGAGAAGTCGAAGAGATCGATAACAAGGAGTCCATTGAGATGCACAATTATTTGACTAGTGTGTATGAGGAAGGTGATGCTCGCTCGACGTTGGTCACG
ATGTTACAGTCGTTGTATCACGCCAAGAACGGAGTCGACCTCGTTTCCGGGACTCGA
GTATGTGTCATTCAACACCAGCTTCCATCTTTCTCCGAAAGTTTCTGTTCAGTTCCATGATGT
ACCCATCTCTTTCCGCAACGTCAACTCACTGAACTAACATGTTTTCTTCCTTAATCCTCGCAGGCACGGACACATTTTGCTAGGCCCAACTGGAAGGATGTCTTTGCAAATCTAACTTTC
ACTCACCCTGAAAAGCGAATCG
GTAAGAAATGATCTGAAGCAAACTTGAATTTTCTGAATCAACGTTTTGGTTAGTTTATGGGTCGGAGTCATTCATTTAAGGGTTGCTAAGCTAAAAAT
TTCCATCGTGCAAGTTTCGCAGGGGTTTTCTACTGTGGCCCTGCAGCACTAGTAAACGAGCTTGAGACTCTATCTCGAACCTACACAAAGGAGTCGTCCACAAAATTTTCCTTCCACAAA
GAGAATTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGAAACAGTTGAGCAATGAGTTCCATCGATATCCACGAAGTGCTTCCAGGGTTCAAGATTTGGACAACTCCGTGGACGAGCGGGGAGTTCTGGATTCCGAGCTCGGAAACTGTGGC
TCAACCAGGAAAATGCAAAAAAGTACTTCGCGCGCGGAATATGCAATCAAAGCTGTGCGGTGTATCAGCAAGGCCACTGCTACCGCAGACCAAAAGAAGTCGTGGCAGAAAGTAGAAGAA
CGGTTTCACAAGCTTCGTGACGCTGATTCTATGTTGCCTCGTTTCTATTTTCCCGAATGCATCG
GAATGAAGGAATCCAAGGAATTTGCTCTGGAGCTCTTTGATGCGTTGGTGCGTCGT
AAAGGCGAGAAGGTGAATAGCATCAGCAAAGATGGCTTATACCAGTTTTGGTTGGAAATCACAGATAAAAGCTTCGACGCCAGGATGCAGATGTTCTTTGACCT
GTGTGACAAGGATTTG
GACGGTCGAATTTCAGGCGAGGAAGTGAAGCAAGTGATCATGTTGAGTGCAAGTGCGAACAAGTTGTCAAAACTGAAGGAGCAGGCGGCAGAGTATGCAGCCCTTATTATGGAAGAACTT
GATGTGAATCGTAATGGTTACATAGAG
TTGAGTCATTTAGAGACATTGTTGCGCGAATCGGTGTTGCCGGGGCATGGAAAAGAGGCAACAATGAACAACCACCAATTGTTGATAAAGAGG
AGCAAGCGATCCAGGATTCGCAGCTTCGCTGAGAAGACGAGGAACTGCTTTCAGGATAATTGGAAACGGTTGTGGATATTGGCTCTGTGGATGATGGCCATGACAGGACTTTTCATTTGG
AAGTTTTTTCAGTATCGGGAGCACGCTGCGTTTCCAATCATGGGCAACTGTCTTTGCGTCGCCAAGGGCGCAGCTGAGACTTTGAAGCTGAACATGGCGCTCGTTCTCCTGCCCGTTTGC
CGCAACACGCTCACACGGTTGAGGTCCACGCGATTAGGAAAGATCATTCCTTTCGACGACAATCTCGACTTTCACAAGGAAA
CCGGAGGTATAGCAGCCGGGGTGTTCATTCATGGTGTT
TGTCACATAACCTGCGACATTCCCAAATTCGTCGAAAGTGGCGATGATAAATTCTTCAAGTACCTCGGCGACGAATTCGAAAAGCACCCAACCTACGCTAACATTGCAGTGATGCCAGTG
GCGATCACGGGTATTCTCATGGTGGTTTTCATGATAATTGCCTTCTTACTAGCCACTCACTGGTTCCGTCGCAGCATGGTGAAGCTTCCGTGGCCATTGCAGCGTCTGACGGGATTCAAT
GCATTCTGGTATTCACATCACCTGTTCGTGATTGTATACGCACTCCTCATGGTCCACTCCATCAAGCTACTTCTTGCTGGTCCATGGTACAAGCGAACG
ACATGGATGTACATCGCTATC
CCCTTACTTTTATACGCAGGCGAACGGATGCTGCGATTGTACCGCACCAACTCCAGCAAAGTGGAGATCGTGAAG
GCTGCAATTTACACCGGTAACGTCCTTGCTATCCACATCACAAAA
CCCCAGGGCTTCAAGTACAAGAGCGGCATGTACCTCTTCTTGCAGTGCCCCCAAATCTCCTCTTTTGAATGGCACCCATTCTCCATAACGTCTGCCCCCGGTGACCCTTTCCTCAGTGTT
CACATCCGCACACTGGGTGACTGGACTGCGGAGATGAAGAAAATCTTCTCTGAGGCTTGCGGTGGACGAACGTGCCTTCAAACTATCAACAATTATGGCCTCAGTGGTGAGCTGACTCTA
GCTGCAAG
ATTCCCAAAGTTGTTCGTCGATGGTCCGTATGGAGCTCCCGCTCAAGACTACCTGAAATATGATGTGCTGCTCCTGGTTGGACTCGGAATTGGAGCAACGCCATTTATTAGT
ATCCTCAAGGACATGCTTCATCACACCAGATATGACCTTTCTGATCCGGTAATGAAACCATGTGATCGTGAATCATGTCGTTTGAGAGCTCC
CTTAACACCAAGTTTACGCCCAACCGAA
AGTCCAAAGAAAAAGAAGAAAAGCAAGAGGAAACCGAAAGCTTACTTCTACTGGGTCACACGAGAGCAAGGCTCCTTCGACTGGTTCAGAGGAATCATGCGAGAAGTCGAAGAGATCGAT
AACAAGGAGTCCATTGAGATGCACAATTATTTGACTAGTGTGTATGAGGAAGGTGATGCTCGCTCGACGTTGGTCACGATGTTACAGTCGTTGTATCACGCCAAGAACGGAGTCGACCTC
GTTTCCGGGACTCGA
GCACGGACACATTTTGCTAGGCCCAACTGGAAGGATGTCTTTGCAAATCTAACTTTCACTCACCCTGAAAAGCGAATCGGGGTTTTCTACTGTGGCCCTGCAGCA
CTAGTAAACGAGCTTGAGACTCTATCTCGAACCTACACAAAGGAGTCGTCCACAAAATTTTCCTTCCACAAAGAGAATTTCTGA

Retrieve as FASTA