Entry information : PpaRboh03-3
Entry ID 6089
Creation 2008-01-30 (Christophe Dunand)
Last sequence changes 2008-01-30 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2012-04-19 (Catherine Mathe)
Peroxidase information: PpaRboh03-3
Name PpaRboh03-3
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaRboh03-3
start..stop
S start..stop
PpaRboh03-1 1284 0 119..886 2..775
PpaRboh03-2 1229 0 75..886 1..827
PpaRboh03-4 1170 0 87..886 2..800
MpRboh02 1016 0 1..886 108..1023
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 153259..153784 526 N° 2 152976..153135 160 N° 3 152685..152847 163 N° 4 152170..152586 417
N° 5 151585..152064 480 N° 6 151212..151479 268 N° 7 150889..151109 221 N° 8 150620..150727 108
N° 9 150390..150518 129 N° 10 150186..150264 79 N° 11 149949..150058 110  
complement(join(149949..150058,150186..150264,150390..150518,150620..150727,1508 89..151109,151212..151479,151585..152064,152170..152586,152685..152847,152976..1 53135,153259..153784))


exon

Literature and cross-references PpaRboh03-3
DNA ref. Phytozome 11:   scaffold_241 (153784..149949)
Protein sequence: PpaRboh03-3
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   886
PWM (Da):   %s   100887.5 Transmb domain:   %s   o337-356i476-498o513-535i707-724o
PI (pH):   %s   8.81
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRELSFLLSEEHVTLRRISPVDIPEIAISGENQKWEGRSIVNDCDAQRPSSLSRVLSSSCHSGSFRESIKTVGCLVKQFSLDLARNSRNVSRVQDLGSPPSYRGVPDPELGDCTSIRKQGSTSSRAEYAIKGLRYISKATATADQKKSWEQVEARFLKLADSENMLHRTNFAECIGMSDSKEFASELFDALVRRKGIEVESITKDELYEYWLQVADRSFDARMQIFLGLCDKDLDGRITGEEVKQVIMLSASANKLSKLKDQAAEYAALIMEELDVDRVGYILSQLETLMRQSILGLGREVTVNYTHVLTTRTERSKIIKLAEKCVHFFLDNWKRIWILALWMSVMAALFAWKFLQYRDRSSWWIMGDCLCVAKGAAETLKLNMALILLPVCRNTLTRLRSTRLWKIIPFDDNLDFHKASQIVAGGMAAGVFLHVGCHATCDLPRFVNADKETFFKHLGDHFDTQPTYSDILNMSVGYSGVIMLVIMIIAFLLATHWFRRSLVKLPWPFHRLMGFNAFWYSHHLFVIVYALLLLHGTKLLLPSPWHERTTWMYIAVPLLLYAGERLLRMYRTNSSKVDVIKAAIYSGNVLAIHMSKPEGFKYKSGMYLFLQCPEISSFEWHPFSITSAPEDPFLSVHIRTLGDWTGEMMKIFADACGGRMRLQTVNNYGFILVGHLTYRSCCHRFPKLYIDGPYGAPAQDYLKYDVLLLVGLGIGATPFISILKDMLHHTRNDSSGHSYPVLTKAKRKPKAYFYWITREQGSFDWFRGVMREVEEIDNKRSIEMHNYLTSVYEEGDARSTLVMMLQALHHAKNGVDLVSGTRARTHFARPNWKSVFSGLTATHQDKRIGVFYCGPAALANELENLSRSYTQTSSTKFSFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (10 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGGGAACTAAGTTTTCTTTTGAGTGAGGAACATGTTACCTTGCGTAGGATAAGCCCAGTAGACATTCCTGAGATTGCGATATCGGGAGAGAATCAGAAGTGGGAGGGGAGAAGCATT
GTGAATGATTGCGATGCTCAGCGACCGAGTAGTTTGAGTCGTGTCTTGTCCTCATCGTGTCACTCAGGCTCGTTCAGGGAAAGCATCAAGACGGTGGGGTGCTTAGTGAAGCAGTTTAGC
CTTGACCTTGCTAGGAATTCGCGGAATGTATCCAGGGTTCAAGACTTGGGCAGCCCACCGTCCTATAGGGGCGTTCCCGACCCTGAGCTTGGAGATTGTACCTCCATTAGAAAGCAGGGG
AGTACATCTTCTCGGGCGGAATATGCGATCAAGGGGCTGCGATACATCAGCAAGGCTACCGCCACAGCTGACCAAAAGAAGTCCTGGGAGCAAGTAGAGGCGCGGTTCCTCAAGCTCGCC
GACTCAGAGAATATGCTACATCGCACCAATTTTGCCGAATGCATCG
GTGTGTGTCGTTGACAGCCGGTTCTGACAACAAAAGAGCTATTTGTACGTAGTATATTCAACATTTATGAAACG
CTGAGCGACATCTAGTTGAGAAATGATAAGGAAGTGGTGTTTTGCACAGGGATGAGTGACTCCAAGGAGTTTGCAAGTGAGCTCTTCGACGCTCTGGTGCGTCGGAAAGGCATTGAGGTG
GAAAGCATCACTAAAGATGAATTGTACGAGTACTGGTTGCAGGTTGCGGACAGAAGCTTCGACGCTCGGATGCAGATATTTTTGGGCTT
GTAATTGAATCCCCTGCCTCAGCCTCTGCTG
TTGCAAATCTCGTGGACATTATAATGCAATACACCCGGTCTGGAATGAAGCATGAGTTTCTCTAAGGGATTCAACCTGATCCTTTTCCGCTTGGCAGGTGTGACAAGGATTTAGATGGTC
GCATCACCGGCGAGGAAGTGAAACAGGTAATAATGTTGAGTGCGAGTGCGAATAAGTTGTCCAAGTTGAAGGATCAGGCCGCCGAATATGCAGCCTTGATCATGGAAGAGCTCGACGTGG
ATCGCGTCGGCTACATTGAG
GTACCTGCTTGTGATTCCTCGATTCGAAACTAAGCTCTTGAAAATTGCAAAGAAATGGAGAGATCGGGCACTAATGGATGGGAGTTGGGTGCTCGCAGCT
GAGTCAATTGGAGACTCTGATGCGCCAATCGATACTGGGACTTGGGAGGGAGGTTACCGTGAATTACACCCATGTATTGACAACGAGAACTGAACGATCCAAGATAATAAAATTGGCTGA
GAAATGTGTCCACTTCTTTTTAGACAATTGGAAACGAATATGGATACTCGCCCTGTGGATGTCGGTCATGGCGGCTCTCTTCGCATGGAAATTTCTCCAGTACCGGGATCGCAGTTCATG
GTGGATCATGGGCGATTGTCTCTGCGTGGCGAAAGGTGCAGCTGAGACACTGAAGCTGAATATGGCGCTCATCCTCCTCCCCGTCTGCCGCAACACTCTGACAAGGCTGCGGTCTACGCG
ATTGTGGAAGATCATCCCGTTTGACGACAATCTCGATTTCCACAAGGCAAGTCAA
GTCTTCTTTTACCTCCTCAGCCTTCTTCAGCCCCATTTCTGACAACCAGAAAAAAATTCAAGAGA
ACAGACACCAGAATGCATGATAGTGTCATGATCTGTGCAGATTGTCGCCGGAGGCATGGCAGCAGGGGTGTTTCTCCACGTTGGTTGCCACGCAACTTGTGATCTCCCGAGGTTCGTCAA
TGCGGATAAAGAAACTTTCTTCAAGCATCTGGGTGACCATTTCGATACACAACCTACGTACTCTGACATTCTGAATATGTCAGTGGGATACAGTGGTGTGATTATGCTCGTGATCATGAT
TATCGCCTTCTTGCTGGCAACTCATTGGTTCCGTCGGAGCCTGGTCAAGCTGCCATGGCCATTCCACCGGTTGATGGGGTTCAACGCGTTCTGGTACTCGCATCACCTGTTCGTCATCGT
ATATGCCCTCCTCCTTCTGCATGGAACTAAGCTCCTTCTCCCGAGTCCATGGCATGAGCGCACGACATGGATGTACATTGCAGTGCCTCTGCTTTTGTATGCGGGAGAACGGCTCCTGCG
AATGTACCGAACTAATTCCAGCAAGGTGGACGTTATCAAG
GTAATTTTCGCCGTTTGTCTCCTTGATGACGTGTGAATTGATTTACTTTTCAATTCTTGTACAACATTGAGGTGTGGCGT
TGATAAACCTTCATCATGCGAGCAGGCGGCGATTTACTCCGGCAACGTCCTCGCCATTCATATGTCCAAACCAGAGGGCTTCAAGTACAAGAGTGGCATGTACCTATTCTTGCAGTGTCC
TGAAATCTCCTCGTTTGAATGGCACCCATTCTCTATCACTTCTGCCCCGGAAGATCCTTTTTTGAGTGTACATATCCGTACACTTGGTGACTGGACCGGTGAGATGATGAAAATCTTCGC
GGATGCTTGTGGTGGGCGTATGCGCCTGCAAACTGTGAATAATTATGGGTTCA
GTGGTGAATTGACTTTGGCTGCAAGGTACTCTTTCATCGCCATACCATTGAACACCACACAAGCCCT
CTGAAAGTTAAGAATTGCATACTGATGTAACCAAGTTTTAGTGGGTCATCTCACCTATCGGTCCTGTTGTCACAGATTTCCGAAGCTGTACATCGATGGCCCTTATGGTGCTCCTGCGCA
AGATTATCTCAAGTATGACGTACTCCTTCTTGTTGGACTCGGGATTGGGGCGACACCATTCATCAGCATCCTCAAGGACATGCTTCACCATACCCGAAACGACTCGTCGGGACATTCTTA
TCCGGTGCTGACCACT
GTCCTACATGCCTAGGTTTTTCTCATCTAAGAACTACGTTATGTTCCTTATTTTTATTTTCTTTGAAGGATACAATGATTGACTAGACTTGTTCTGCGTGATTT
AAGAGCTCAACTCCTGACTTACGCCCAACGGAAAGCCCCAGAACTAGAAGCAAGAAGAAGGCCAAGAGGAAGCCCAAGGCATACTTTTACTGGATTACCCGAGAGCAAGGCTCCTTCGAT
TGGTTCAGAGGAGTCATGCGAGAAGTTGAGGAGATTGATAACAAG
GTGATTGCATCTTTTTTGTTTTTGTTGTGCTTTAAATTTCTCGAGACTCCGACGATCTATTAGAGAACTGAATTT
GTTGTGTTGCGCCATGGTATTTGCAGAGGTCTATTGAGATGCACAATTATTTGACTAGCGTTTATGAGGAAGGTGATGCTCGGTCCACGTTGGTCATGATGCTGCAAGCCTTGCACCACG
CTAAGAATGGAGTGGACCTGGTTTCAGGCACTCGC
GTATGTGTCCACACCACTCTTCAGACTTCGCATCTCTTATCTAGAATTATTTCCTACATGTTTCTAGTTATTTGATGCATGCTAT
TGTACAATTGTAATGAATTAACCTTCTTTTCACTTGGCAGGCACGCACACATTTTGCCAGACCCAACTGGAAGAGCGTCTTCTCGGGGCTGACTGCCACCCACCAGGACAAGCGTATCGG
TATGAATCTGTCAACCGTACTGTTGAAGGGTTTTTTTGGGGCCCTCCTCCCCGCTGATTTGTATCAGCACTATAGTACATGCAAGGTTGAGAACCTAAAAGTTGTAATTGATTATACATT
TTGCAGGGGTGTTTTACTGTGGTCCTGCAGCTCTTGCGAATGAACTTGAGAACCTATCAAGATCATACACACAGACGTCTTCAACGAAATTCTCCTTCCACAAGGAAAACTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGGGAACTAAGTTTTCTTTTGAGTGAGGAACATGTTACCTTGCGTAGGATAAGCCCAGTAGACATTCCTGAGATTGCGATATCGGGAGAGAATCAGAAGTGGGAGGGGAGAAGCATT
GTGAATGATTGCGATGCTCAGCGACCGAGTAGTTTGAGTCGTGTCTTGTCCTCATCGTGTCACTCAGGCTCGTTCAGGGAAAGCATCAAGACGGTGGGGTGCTTAGTGAAGCAGTTTAGC
CTTGACCTTGCTAGGAATTCGCGGAATGTATCCAGGGTTCAAGACTTGGGCAGCCCACCGTCCTATAGGGGCGTTCCCGACCCTGAGCTTGGAGATTGTACCTCCATTAGAAAGCAGGGG
AGTACATCTTCTCGGGCGGAATATGCGATCAAGGGGCTGCGATACATCAGCAAGGCTACCGCCACAGCTGACCAAAAGAAGTCCTGGGAGCAAGTAGAGGCGCGGTTCCTCAAGCTCGCC
GACTCAGAGAATATGCTACATCGCACCAATTTTGCCGAATGCATCG
GGATGAGTGACTCCAAGGAGTTTGCAAGTGAGCTCTTCGACGCTCTGGTGCGTCGGAAAGGCATTGAGGTGGAA
AGCATCACTAAAGATGAATTGTACGAGTACTGGTTGCAGGTTGCGGACAGAAGCTTCGACGCTCGGATGCAGATATTTTTGGGCTT
GTGTGACAAGGATTTAGATGGTCGCATCACCGGC
GAGGAAGTGAAACAGGTAATAATGTTGAGTGCGAGTGCGAATAAGTTGTCCAAGTTGAAGGATCAGGCCGCCGAATATGCAGCCTTGATCATGGAAGAGCTCGACGTGGATCGCGTCGGC
TACATTGAG
CTGAGTCAATTGGAGACTCTGATGCGCCAATCGATACTGGGACTTGGGAGGGAGGTTACCGTGAATTACACCCATGTATTGACAACGAGAACTGAACGATCCAAGATAATA
AAATTGGCTGAGAAATGTGTCCACTTCTTTTTAGACAATTGGAAACGAATATGGATACTCGCCCTGTGGATGTCGGTCATGGCGGCTCTCTTCGCATGGAAATTTCTCCAGTACCGGGAT
CGCAGTTCATGGTGGATCATGGGCGATTGTCTCTGCGTGGCGAAAGGTGCAGCTGAGACACTGAAGCTGAATATGGCGCTCATCCTCCTCCCCGTCTGCCGCAACACTCTGACAAGGCTG
CGGTCTACGCGATTGTGGAAGATCATCCCGTTTGACGACAATCTCGATTTCCACAAGGCAAGTCAA
ATTGTCGCCGGAGGCATGGCAGCAGGGGTGTTTCTCCACGTTGGTTGCCACGCA
ACTTGTGATCTCCCGAGGTTCGTCAATGCGGATAAAGAAACTTTCTTCAAGCATCTGGGTGACCATTTCGATACACAACCTACGTACTCTGACATTCTGAATATGTCAGTGGGATACAGT
GGTGTGATTATGCTCGTGATCATGATTATCGCCTTCTTGCTGGCAACTCATTGGTTCCGTCGGAGCCTGGTCAAGCTGCCATGGCCATTCCACCGGTTGATGGGGTTCAACGCGTTCTGG
TACTCGCATCACCTGTTCGTCATCGTATATGCCCTCCTCCTTCTGCATGGAACTAAGCTCCTTCTCCCGAGTCCATGGCATGAGCGCACGACATGGATGTACATTGCAGTGCCTCTGCTT
TTGTATGCGGGAGAACGGCTCCTGCGAATGTACCGAACTAATTCCAGCAAGGTGGACGTTATCAAG
GCGGCGATTTACTCCGGCAACGTCCTCGCCATTCATATGTCCAAACCAGAGGGC
TTCAAGTACAAGAGTGGCATGTACCTATTCTTGCAGTGTCCTGAAATCTCCTCGTTTGAATGGCACCCATTCTCTATCACTTCTGCCCCGGAAGATCCTTTTTTGAGTGTACATATCCGT
ACACTTGGTGACTGGACCGGTGAGATGATGAAAATCTTCGCGGATGCTTGTGGTGGGCGTATGCGCCTGCAAACTGTGAATAATTATGGGTTCA
TTTTAGTGGGTCATCTCACCTATCGG
TCCTGTTGTCACAGATTTCCGAAGCTGTACATCGATGGCCCTTATGGTGCTCCTGCGCAAGATTATCTCAAGTATGACGTACTCCTTCTTGTTGGACTCGGGATTGGGGCGACACCATTC
ATCAGCATCCTCAAGGACATGCTTCACCATACCCGAAACGACTCGTCGGGACATTCTTATCCGGTGCTGACCACT
AAGGCCAAGAGGAAGCCCAAGGCATACTTTTACTGGATTACCCGA
GAGCAAGGCTCCTTCGATTGGTTCAGAGGAGTCATGCGAGAAGTTGAGGAGATTGATAACAAG
AGGTCTATTGAGATGCACAATTATTTGACTAGCGTTTATGAGGAAGGTGATGCTCGG
TCCACGTTGGTCATGATGCTGCAAGCCTTGCACCACGCTAAGAATGGAGTGGACCTGGTTTCAGGCACTCGC
GCACGCACACATTTTGCCAGACCCAACTGGAAGAGCGTCTTCTCGGGG
CTGACTGCCACCCACCAGGACAAGCGTATCG
GGGTGTTTTACTGTGGTCCTGCAGCTCTTGCGAATGAACTTGAGAACCTATCAAGATCATACACACAGACGTCTTCAACGAAATTCTCC
TTCCACAAGGAAAACTTCTGA

Retrieve as FASTA