Entry information : PpaRboh03-4
Entry ID 6090
Creation 2008-01-30 (Christophe Dunand)
Last sequence changes 2008-01-30 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2012-04-19 (Catherine Mathe)
Peroxidase information: PpaRboh03-4
Name PpaRboh03-4
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaRboh03-4
start..stop
S start..stop
PpaRboh03-2 1273 0 3..800 14..827
PpaRboh03-3 1152 0 2..800 87..886
PpaRboh03-1 1127 0 34..800 1..775
MpRboh02 990 0 28..800 213..1023
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1428102..1428372 271 N° 2 1428507..1428666 160 N° 3 1428803..1428965 163 N° 4 1429095..1429509 415
N° 5 1429652..1430022 371 N° 6 1430136..1430231 96 N° 7 1430357..1430649 293 N° 8 1430769..1430931 163
N° 9 1431050..1431334 285 N° 10 1431462..1431540 79 N° 11 1431682..1431788 107  
join(1428102..1428372,1428507..1428666,1428803..1428965,1429095..1429509,1429652 ..1430022,1430136..1430231,1430357..1430649,1430769..1430931,1431050..1431334,14 31462..1431540,1431682..1431788)


exon

Literature and cross-references PpaRboh03-4
DNA ref. Phytozome 11:   scaffold_18 (1428102..1431788)
Cluster/Prediction ref. UniGene:   Ppa.13718
Protein sequence: PpaRboh03-4
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   800
PWM (Da):   %s   90955.76 Transmb domain:   %s   o253-272i387-409o435-457i612-629o
PI (pH):   %s   9.34
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTRNASKAQDYITPVEQSESPDLELGRPGSPRNMQKSTSRAEYALQAVRCISKATATDDEKKLWEKVEQRFVKLADADSMLPRSNFAECIGMKESKEFANELFDALVRCKGEKVNSISKQELYQYWLVIANKSFDGRMQMFFALCDKDLDGRITAEEVKQVIVLSASANKLSVLKEQASEYAALIMEELDVNRNGYILSEFESLMRGSVMAANGKEPTVQYNQMLKQKSKRTKVQDATGKAKHFLHDYWKRLWILALWVMAMTGLFTWKFLQYRHHEAYAVMGECLCVAKGAAETLKLNMALILLPVCRNMLTRLRSTRLGKLIPFDENLDFHKATIAVGVFVHGTLHITCDIPKFVNCDDEKFFEALGDQFDKHPTYADIAVTPVAITGILMVVLMAIAMLLATHWIRRSLVKFPWPLHRLTGFNTFWYSHHLFVIVYALLLVHSIKLLLAGSWYKRIWMYTAVPLVLYASERFLRLYRTNYSKVEVVKAAVYTGNVLAIHMTKPAGFKYKSGMYLFLQCPAISSFEWHPFSITSAPDDPFLSVHIRTLGDWTTEMRKIFSDSLGGKTRLQAINDYGLSGELTLAPRFPKLYIDGPYGAPAQDYLKYDVLLLVGLGIGATPFISILKDMLHHSRNDSVSDSSSPDLNPTGSPPPKKKAKRDPKAYFYWVTREQGSFDWFRGIMREVEEIDNKELIEMHNYLTSVYEEGDARSTLVTMLQSLHHAKNGVDVVSGTRARTHFARPNWKNVFTNMADTHPNKRIGVFYCGPASLVNELKTLSKAFTKKSTKFFFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (11 introns) and 2 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACACGAAACGCATCGAAGGCCCAGGATTACATCACCCCGGTTGAGCAGTCAGAGTCTCCTGATCTTGAGCTCGGAAGACCGGGTTCTCCCAGAAACATGCAGAAGAGTACCTCGCGC
GCGGAGTACGCACTTCAGGCCGTTCGGTGCATCAGTAAGGCGACCGCCACAGATGACGAGAAGAAGTTGTGGGAGAAAGTAGAGCAACGGTTCGTCAAGCTTGCGGACGCTGATTCCATG
TTGCCTCGTTCCAATTTTGCCGAATGCATTG
GTATGTTCGAAGACCCTCTACATTCCACATCTATCACAAGACATATTCCATATATCTAGTTCTGTGGACAGTGACGGAATTGGAATGTG
TGTTTGCTTGAAGTAACTAATATCGTTGCTACTGCATGTGCACAGGAATGAAGGAATCGAAGGAGTTTGCTAATGAGCTCTTCGATGCGCTGGTTCGTTGCAAAGGCGAGAAGGTGAACA
GCATCAGCAAACAGGAATTGTACCAGTATTGGTTGGTAATTGCGAACAAAAGCTTCGACGGCCGCATGCAAATGTTCTTCGCCTT
GTAAATTGCCTAGACCTTGTTCTTTCATACCTGAT
CTCACAAAAAATCATCTCATTTCCTCCATATCTTGATCAGTTGAAAATGTGGATTGAGTGAGCCTGACGGAAAAAAACCAAGTTTTCATATCTTTTGATAGGTGTGATAAGGATCTGGAT
GGTCGCATCACGGCCGAGGAAGTGAAGCAAGTGATAGTGTTGAGCGCGAGTGCGAACAAGCTGTCTGTATTGAAGGAGCAGGCATCAGAGTACGCTGCGCTTATTATGGAAGAACTCGAC
GTGAATCGTAATGGTTACATAGAG
GTGTGCACTTGAGTTCTTCTCCAATCACTAGCAATTATTTGTTAAGTATCGCACACTCATACGCACACACACACCATTGTTGAAGCTTTAAGAATG
GTTCACCGACAATTCGACTATGTGTGATTGCAGCTGAGTGAGTTTGAGTCACTCATGCGCGGATCTGTGATGGCTGCAAATGGAAAAGAACCAACAGTACAGTATAACCAAATGTTAAAG
CAGAAGAGCAAGCGAACAAAAGTGCAGGATGCCACAGGAAAGGCTAAACACTTCTTGCACGATTACTGGAAGCGGTTGTGGATACTCGCCCTTTGGGTGATGGCCATGACAGGACTCTTC
ACTTGGAAGTTTCTTCAGTATCGGCATCACGAGGCATATGCAGTCATGGGTGAGTGTCTCTGCGTCGCTAAAGGCGCAGCGGAGACACTGAAGCTCAACATGGCCCTCATTCTGCTGCCT
GTATGTCGCAACATGCTCACAAGGCTTCGGTCCACGCGATTAGGCAAGCTCATTCCCTTCGACGAGAATCTCGACTTTCACAAGGCAA
GTCTCCTTCCTGATCCGGAGCATGTCAGAGAT
AGAAAATTCACTAGCAAGTTGGTAAAAAAGCCGTGAGCAGGTTGCTAATAGTCAAATTGTGGCGTCTGAATTGGATTTGCGAAACTGGGCTGTGCAGTGTATCGCTGCAGCTATAGCAGT
GGGAGTGTTCGTGCATGGAACTCTTCACATAACCTGCGATATCCCAAAATTTGTCAATTGTGACGATGAAAAGTTCTTTGAGGCTCTCGGCGACCAATTCGACAAGCACCCCACATACGC
TGACATTGCCGTGACGCCAGTGGCAATCACGGGCATTCTCATGGTAGTTCTTATGGCAATCGCCATGCTGCTCGCCACCCACTGGATCCGTCGCAGCTTGGTGAAGTTTCCATGGCCGCT
GCACCGACTCACGGGATTCAATACATTCTGGTACTCTCACCACTTGTTCGTGATCGTCTACGCGCTTCTCCTGGTCCACTCCATCAAGCTCCTTCTCGCTGGTTCGTGGTACAAGCGAAC
G
GTATGATTTCTTTTCCAACACCAACATCATCAAAAGTTTCGCAAATTTGATAAGAACTCTACTACTTGACAAATTGTTGAAGGTATCTAACACTGATCTTCGACGGTGTGCAGATATGG
ATGTACACTGCCGTCCCCTTGGTTCTGTATGCCAGCGAACGGTTCTTGCGATTGTATCGGACGAATTACAGCAAGGTGGAGGTCGTGAAG
GTGACGATCAGATCACAATTTGATGCATAC
AAAAACATGGTTCAGCTTCTTACTTTTGCAATGCCTGTCTCACTTCCACTGCAATGGTGGTGTGGTTCTGACGACGATTTGTCTTGTCTGAGCAGGCTGCAGTCTACACCGGCAACGTGC
TCGCTATCCACATGACGAAACCCGCTGGCTTCAAATACAAAAGTGGCATGTATCTTTTCTTGCAATGCCCCGCAATCTCCTCGTTTGAATGGCACCCATTCTCCATCACATCCGCCCCGG
ATGATCCTTTCCTAAGCGTGCACATCCGCACTTTGGGTGACTGGACTACGGAGATGAGGAAGATCTTCTCTGATTCGTTGGGAGGGAAAACGCGCCTGCAAGCTATCAACGATTATGGCC
TCAGCGGTGAACTAACTCTGGCTCCAAG
GTACTCGATCTTTCACCTCCTTACAAACCCTAAGTTGCATGAAAGTGGTTTTCGATATTGAAGCTAAGCAAATTGTTCCAGCGTTAATCTCT
ATAATCGGTGTTTGTGCCCAATCGTAGATTTCCGAAGCTGTACATCGATGGTCCTTATGGAGCTCCCGCTCAAGACTACCTCAAGTATGATGTGTTGCTTCTCGTTGGGCTTGGAATTGG
TGCAACTCCATTTATCAGTATCCTCAAGGACATGCTTCATCACAGTAGAAACGATTCAGTTTCTGATCTA
GTACTTAAAGCCCTCCTCTACTCCTGAATTCTGTCGGTTTAACATCCTTC
AGTTTACTTTCTTTTTGCTCCCAAGGCTGCTAGAATTGACTGGAGGTGACTCGCTTTTCTAACTCCAGAGCTCATCCCCTGATTTAAACCCAACTGGAAGTCCTCCTCCGAAGAAGAAAG
CCAAGAGGGACCCTAAGGCATACTTCTACTGGGTCACCCGAGAGCAAGGCTCCTTCGATTGGTTCAGAGGAATTATGCGAGAAGTCGAAGAGATCGACAACAAGGAGCTCATTGAGATGC
ACAACTACTTGACAAGCGTGTACGAGGAAGGCGATGCTCGCTCGACGTTGGTCACGATGTTGCAGTCGTTGCACCATGCCAAGAATGGAGTCGACGTCGTTTCAGGCACTAGG
GTATGTG
AATTGACATCCGTTTCATGTTTGCACCTCAAACCGTCATTCAAACCTTCTGCGATGTACTCATCTCGTTTTGGAGCCCTAATCCAATGCATTAACATGGATTTTCCCTGATATTTTGCAG

GCACGTACCCATTTTGCAAGGCCTAACTGGAAGAACGTTTTCACTAACATGGCCGACACGCATCCAAACAAGCGAATCG
GTACTGTTCAATCTCCCCCACTCGATCTTTGGCTTCGCACC
GCCAATTTTTTCCTATTTTTCGTCAACTTCTTCGTCAGTTAAGGGGGTTGAGTCATATAATTTAGGTCTTATCTAAGACTTCCTGTTTTGTGTTTTGCAGGGGTGTTTTACTGTGGCCCT
GCATCACTTGTAAACGAGCTCAAGACTCTATCGAAAGCATTCACAAAGAAGTCCACAAAATTCTTCTTCCACAAAGAAAATTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACACGAAACGCATCGAAGGCCCAGGATTACATCACCCCGGTTGAGCAGTCAGAGTCTCCTGATCTTGAGCTCGGAAGACCGGGTTCTCCCAGAAACATGCAGAAGAGTACCTCGCGC
GCGGAGTACGCACTTCAGGCCGTTCGGTGCATCAGTAAGGCGACCGCCACAGATGACGAGAAGAAGTTGTGGGAGAAAGTAGAGCAACGGTTCGTCAAGCTTGCGGACGCTGATTCCATG
TTGCCTCGTTCCAATTTTGCCGAATGCATTG
GAATGAAGGAATCGAAGGAGTTTGCTAATGAGCTCTTCGATGCGCTGGTTCGTTGCAAAGGCGAGAAGGTGAACAGCATCAGCAAACAG
GAATTGTACCAGTATTGGTTGGTAATTGCGAACAAAAGCTTCGACGGCCGCATGCAAATGTTCTTCGCCTT
GTGTGATAAGGATCTGGATGGTCGCATCACGGCCGAGGAAGTGAAGCAA
GTGATAGTGTTGAGCGCGAGTGCGAACAAGCTGTCTGTATTGAAGGAGCAGGCATCAGAGTACGCTGCGCTTATTATGGAAGAACTCGACGTGAATCGTAATGGTTACATAGAG
CTGAGT
GAGTTTGAGTCACTCATGCGCGGATCTGTGATGGCTGCAAATGGAAAAGAACCAACAGTACAGTATAACCAAATGTTAAAGCAGAAGAGCAAGCGAACAAAAGTGCAGGATGCCACAGGA
AAGGCTAAACACTTCTTGCACGATTACTGGAAGCGGTTGTGGATACTCGCCCTTTGGGTGATGGCCATGACAGGACTCTTCACTTGGAAGTTTCTTCAGTATCGGCATCACGAGGCATAT
GCAGTCATGGGTGAGTGTCTCTGCGTCGCTAAAGGCGCAGCGGAGACACTGAAGCTCAACATGGCCCTCATTCTGCTGCCTGTATGTCGCAACATGCTCACAAGGCTTCGGTCCACGCGA
TTAGGCAAGCTCATTCCCTTCGACGAGAATCTCGACTTTCACAAGGCAA
CTATAGCAGTGGGAGTGTTCGTGCATGGAACTCTTCACATAACCTGCGATATCCCAAAATTTGTCAATTGT
GACGATGAAAAGTTCTTTGAGGCTCTCGGCGACCAATTCGACAAGCACCCCACATACGCTGACATTGCCGTGACGCCAGTGGCAATCACGGGCATTCTCATGGTAGTTCTTATGGCAATC
GCCATGCTGCTCGCCACCCACTGGATCCGTCGCAGCTTGGTGAAGTTTCCATGGCCGCTGCACCGACTCACGGGATTCAATACATTCTGGTACTCTCACCACTTGTTCGTGATCGTCTAC
GCGCTTCTCCTGGTCCACTCCATCAAGCTCCTTCTCGCTGGTTCGTGGTACAAGCGAACG
ATATGGATGTACACTGCCGTCCCCTTGGTTCTGTATGCCAGCGAACGGTTCTTGCGATTG
TATCGGACGAATTACAGCAAGGTGGAGGTCGTGAAG
GCTGCAGTCTACACCGGCAACGTGCTCGCTATCCACATGACGAAACCCGCTGGCTTCAAATACAAAAGTGGCATGTATCTTTTC
TTGCAATGCCCCGCAATCTCCTCGTTTGAATGGCACCCATTCTCCATCACATCCGCCCCGGATGATCCTTTCCTAAGCGTGCACATCCGCACTTTGGGTGACTGGACTACGGAGATGAGG
AAGATCTTCTCTGATTCGTTGGGAGGGAAAACGCGCCTGCAAGCTATCAACGATTATGGCCTCAGCGGTGAACTAACTCTGGCTCCAAG
ATTTCCGAAGCTGTACATCGATGGTCCTTAT
GGAGCTCCCGCTCAAGACTACCTCAAGTATGATGTGTTGCTTCTCGTTGGGCTTGGAATTGGTGCAACTCCATTTATCAGTATCCTCAAGGACATGCTTCATCACAGTAGAAACGATTCA
GTTTCTGATCTA
AGCTCATCCCCTGATTTAAACCCAACTGGAAGTCCTCCTCCGAAGAAGAAAGCCAAGAGGGACCCTAAGGCATACTTCTACTGGGTCACCCGAGAGCAAGGCTCCTTC
GATTGGTTCAGAGGAATTATGCGAGAAGTCGAAGAGATCGACAACAAGGAGCTCATTGAGATGCACAACTACTTGACAAGCGTGTACGAGGAAGGCGATGCTCGCTCGACGTTGGTCACG
ATGTTGCAGTCGTTGCACCATGCCAAGAATGGAGTCGACGTCGTTTCAGGCACTAGG
GCACGTACCCATTTTGCAAGGCCTAACTGGAAGAACGTTTTCACTAACATGGCCGACACGCAT
CCAAACAAGCGAATCG
GGGTGTTTTACTGTGGCCCTGCATCACTTGTAAACGAGCTCAAGACTCTATCGAAAGCATTCACAAAGAAGTCCACAAAATTCTTCTTCCACAAAGAAAATTTC
TAA

Retrieve as FASTA