Entry information : SmRboh03-1_13 (SmRboh03a_13)
Entry ID 6091
Creation 2008-02-08 (Christophe Dunand)
Last sequence changes 2010-06-01 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmRboh03-1_13 (SmRboh03a_13)
Name (synonym) SmRboh03-1_13 (SmRboh03a_13)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmRboh03-1_13
start..stop
S start..stop
SmRboh03-2_66 1397 0 1..693 87..796
SmRboh04-2_88 971 0 4..693 81..789
SmRboh04-1_39 970 0 4..693 81..788
SmRboh02-2_137 970 0 1..693 184..902
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2053722..2053882 161 N° 2 2053930..2053978 49 N° 3 2054054..2054167 114 N° 4 2054216..2054623 408
N° 5 2054685..2055071 387 N° 6 2055120..2055215 96 N° 7 2055265..2055380 116 N° 8 2055446..2055548 103
N° 9 2055668..2055855 188 N° 10 2055941..2056082 142 N° 11 2056197..2056325 129 N° 12 2056388..2056466 79
N° 13 2056525..2056634 110  
join(2053722..2053882,2053930..2053978,2054054..2054167,2054216..2054623,2054685 ..2055071,2055120..2055215,2055265..2055380,2055446..2055548,2055668..2055855,20 55941..2056082,2056197..2056325,2056388..2056466,2056525..2056634)


exon

Literature and cross-references SmRboh03-1_13 (SmRboh03a_13)
DNA ref. Phytozome 11:   scaffold_13 (2053722..2056634)
Protein sequence: SmRboh03-1_13 (SmRboh03a_13)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   693
PWM (Da):   %s   79440.13 Transmb domain:   %s   o159-181i208-230o245-264i292-314o343-365i511-528o
PI (pH):   %s   9.53
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSDSKEFAELLFDALARRKGHDELWTASKEELRDFWLQITDKRFSSRLQTFFDLCDTDLDGRISENEVKIILLSASANKLSFLQEQAEEYAALIMGELDQNKQGYIEVKQLERLMREPIALAEDPSYGYACAPTLHSRRRNRLHLLQRTIKYFALDNWQRIWVLCVWFLAMTGLFTWKFIEYKNRAAFKIMGYCVCTAKGAAETLKLNMALVLLPVCRITITSLRSTVFGSILPFNDNINFHKLIAAAILFGVLLHGGTHIACDFPKMANANSRIFLDTIGHGFHGRQPSFLGILASIEGITGIIMVVLMSIAFLLATHWSRKNIVRLPWPLHRLTGFNAFWYSHHLFILVYALLIIHSVFLFLTPDWQQKTTWIYLSCPLLLYVGERFLRVLRSRQHRVNIVKAAIHPGNVLALDMTKPPGFKYRSGMYMFLQCPAISPFEWHPFSITSAPDDEFLNVHIRTVGDWTKEMRKIFASAAGWLTSPDRFPKLYIDGPYGAPAQDYRKYDVMLLVGLGIGATPFISILKDMLNNIKSTEQHKPFDSPRRKSRKSRGPTNAYFYWVTREQGSFEWFKGVMNEVAEIDHAVIEMHNYLTSVYEEGDARSALIAMVQALHHTKNGVDIVSGTRARTHFARPNWDKVFARLTATHDNSRIGVFYCGPSQVAKELDVLSRKYSQESNTKFIFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (12 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCGATTCCAAGGAATTTGCGGAGTTGCTGTTTGATGCTCTAGCCCGGCGGAAAGGCCATGACGAGCTGTGGACCGCTTCGAAGGAAGAACTCCGGGACTTTTGGCTTCAAATCACG
GACAAGAGATTTAGCTCTCGATTGCAAACATTTTTTGACTT
GTAAGTTGTCCAGTCTTTTCTTTGATTGTTCTAAATTTTATCCATAGGTGTGACACGGATCTGGACGGTCGCATATCAG
AAAACGAAGTGAAAGAG
GTACATATGGAGTTGATTTTACTCCCTCTGCTTTTGTTTGAGCGCTAAACTAAAGGAACAAGCCCCGGATTGCAGATAATTCTACTCAGTGCGTCGGCGAACA
AGCTCTCGTTTCTGCAAGAGCAAGCTGAAGAATACGCAGCTCTCATCATGGGAGAACTCGATCAGAATAAACAAGGATATATTGAG
GTAAGAAGCTTCCTACCACGCAACCTTTCAACGT
TCAACTTATTTCAGGTGAAACAACTTGAACGGTTGATGCGAGAGCCGATCGCACTCGCTGAGGATCCGTCCTATGGGTACGCGTGTGCTCCAACTTTACACTCTCGAAGAAGAAACCGAT
TGCATTTACTCCAGAGAACGATCAAGTACTTCGCTCTGGACAACTGGCAGCGGATATGGGTGCTGTGCGTGTGGTTTCTCGCCATGACCGGTCTTTTCACCTGGAAGTTCATAGAGTACA
AGAACAGAGCCGCTTTTAAGATCATGGGATACTGTGTGTGCACGGCCAAAGGCGCTGCGGAGACTTTGAAACTCAACATGGCATTGGTCCTGCTGCCAGTTTGCAGGATCACAATCACGT
CCTTACGCTCCACTGTTTTCGGATCCATACTACCTTTCAACGACAACATCAACTTTCACAAG
GTATGACTTCGTTTGTTCCTGTGTTTGTACGCATGCTTTCTTACGATGGCCTGTTTTC
CAGCTTATTGCTGCAGCGATTTTGTTCGGCGTTTTGCTTCACGGAGGAACTCATATTGCTTGTGACTTCCCCAAGATGGCCAACGCAAACAGTCGTATATTTCTTGATACTATTGGGCAT
GGTTTCCACGGCCGGCAACCATCTTTCCTTGGCATATTGGCTTCGATTGAGGGGATTACGGGGATTATTATGGTGGTCCTGATGTCGATAGCTTTCCTTCTTGCAACGCACTGGTCCCGC
AAGAACATCGTCAGGCTCCCTTGGCCCCTCCACAGGTTAACAGGATTCAACGCATTTTGGTACTCGCATCATCTTTTTATTTTGGTCTACGCCCTGCTGATCATACACTCGGTGTTTCTC
TTCCTGACCCCAGACTGGCAGCAAAAGACG
GTACCTACATTATGATCTGATTGACTTCTGATATTTTTTGTACTGCAGACGTGGATATATCTATCCTGTCCATTGCTGCTGTACGTTGGC
GAGAGGTTCCTGCGCGTTTTAAGATCGAGGCAGCATCGAGTCAACATAGTAAAG
GTAACTTTCCGCAGCAAATTGTCTCTCACGCTGAAACTTTGTTTCACAGGCAGCAATTCATCCTGG
CAACGTTCTTGCCTTGGACATGACAAAACCTCCAGGCTTCAAGTATCGGAGTGGCATGTACATGTTTCTGCAGTGTCCAGCGATCTCGCCATTCGAGTG
GTAAAAATCTTGGTGACCCTA
GCAAGCAGATTGAAACACTTTTTCTTCTTCTTTTGTGTGGCCAGGCATCCCTTCTCGATCACGTCTGCGCCCGACGACGAGTTTTTAAATGTGCACATACGGACGGTGGGGGACTGGACC
AAGGAAATGAGGAAAATCTTTGCCAAG
GTTTGTTTGCTTCCCCTTCAATGCCTGTCCTGATCCACAGTTGTGCGTAGGCAGTTGACACTAGCTCTTCCATCGACGATTCACGGTCAGTGA
TCCCAACAACCAAACGTTTCCGTTAGTCCGCGGCTGGCTGGCTTACATCCCCTGACAGGTTTCCAAAGCTCTACATTGATGGACCTTATGGCGCTCCTGCTCAGGACTACCGAAAGTATG
ACGTGATGCTCCTCGTTGGCTTGGGAATCGGAGCTACACCTTTTATCAGCATCTTAAAGGACATGCTCAACAACATCAAATCCACGGAGCAACA
GTCGGTAAGCTTCTCTCTTTTGTTTT
CTTGTTCTTTTCTTAGCACAAGTTGTGTTGCTTGCTTGCTCGCAGGACATAGACTTTAGCAAGCCGTTTGATAGCCCGAGAAGAAAGAGCCGCAAGTCTCGTGGCCCAACAAACGCCTAC
TTCTACTGGGTCACCAGAGAGCAAGGCTCGTTCGAGTGGTTCAAAGGCGTCATGAATGAGGTGGCCGAAATAGATCACAAG
GTCAGCCACTCGTCACCAATCTTAAGTCAGCCCCGCAAC
CACGATAGAAGCTCTTGGTTGATTGACTCAAAAGAAAAGATTTATTGCTGACGTATAAAGGTTTTGCTTCCGCAGGCAGTAATTGAGATGCACAACTACCTCACAAGCGTGTACGAGGAA
GGTGACGCGCGCTCGGCTCTCATTGCAATGGTACAAGCTCTACACCACACCAAAAACGGCGTGGATATCGTCTCGGGCACCCGG
GTAAAAAACTTTCATCCCCAGAGCTTTCGCTAAGAT
CTTCTTTTCTTCTTCTTTGTGCCCAGGCACGCACTCACTTCGCAAGGCCAAACTGGGACAAGGTGTTCGCACGTCTCACTGCCACACACGACAATTCAAGGATAGGTAAGAAGAAGAGAA
GAAAATGATGAGAGCAAACTCCACTTACTTTGGTTGTTGTTAGGAGTGTTCTACTGCGGGCCTTCGCAAGTCGCCAAAGAGTTAGATGTGCTGTCCCGGAAATATTCCCAAGAGTCCAAC
ACCAAATTTATATTCCACAAGGAGAACTTTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCGATTCCAAGGAATTTGCGGAGTTGCTGTTTGATGCTCTAGCCCGGCGGAAAGGCCATGACGAGCTGTGGACCGCTTCGAAGGAAGAACTCCGGGACTTTTGGCTTCAAATCACG
GACAAGAGATTTAGCTCTCGATTGCAAACATTTTTTGACTT
GTGTGACACGGATCTGGACGGTCGCATATCAGAAAACGAAGTGAAAGAGATAATTCTACTCAGTGCGTCGGCGAACAAG
CTCTCGTTTCTGCAAGAGCAAGCTGAAGAATACGCAGCTCTCATCATGGGAGAACTCGATCAGAATAAACAAGGATATATTGAG
GTGAAACAACTTGAACGGTTGATGCGAGAGCCGATC
GCACTCGCTGAGGATCCGTCCTATGGGTACGCGTGTGCTCCAACTTTACACTCTCGAAGAAGAAACCGATTGCATTTACTCCAGAGAACGATCAAGTACTTCGCTCTGGACAACTGGCAG
CGGATATGGGTGCTGTGCGTGTGGTTTCTCGCCATGACCGGTCTTTTCACCTGGAAGTTCATAGAGTACAAGAACAGAGCCGCTTTTAAGATCATGGGATACTGTGTGTGCACGGCCAAA
GGCGCTGCGGAGACTTTGAAACTCAACATGGCATTGGTCCTGCTGCCAGTTTGCAGGATCACAATCACGTCCTTACGCTCCACTGTTTTCGGATCCATACTACCTTTCAACGACAACATC
AACTTTCACAAG
CTTATTGCTGCAGCGATTTTGTTCGGCGTTTTGCTTCACGGAGGAACTCATATTGCTTGTGACTTCCCCAAGATGGCCAACGCAAACAGTCGTATATTTCTTGATACT
ATTGGGCATGGTTTCCACGGCCGGCAACCATCTTTCCTTGGCATATTGGCTTCGATTGAGGGGATTACGGGGATTATTATGGTGGTCCTGATGTCGATAGCTTTCCTTCTTGCAACGCAC
TGGTCCCGCAAGAACATCGTCAGGCTCCCTTGGCCCCTCCACAGGTTAACAGGATTCAACGCATTTTGGTACTCGCATCATCTTTTTATTTTGGTCTACGCCCTGCTGATCATACACTCG
GTGTTTCTCTTCCTGACCCCAGACTGGCAGCAAAAGACG
ACGTGGATATATCTATCCTGTCCATTGCTGCTGTACGTTGGCGAGAGGTTCCTGCGCGTTTTAAGATCGAGGCAGCATCGA
GTCAACATAGTAAAG
GCAGCAATTCATCCTGGCAACGTTCTTGCCTTGGACATGACAAAACCTCCAGGCTTCAAGTATCGGAGTGGCATGTACATGTTTCTGCAGTGTCCAGCGATCTCG
CCATTCGAGTG
GCATCCCTTCTCGATCACGTCTGCGCCCGACGACGAGTTTTTAAATGTGCACATACGGACGGTGGGGGACTGGACCAAGGAAATGAGGAAAATCTTTGCCAAGTCCGCG
GCTGGCTGGCTTACATCCCCTGACAGGTTTCCAAAGCTCTACATTGATGGACCTTATGGCGCTCCTGCTCAGGACTACCGAAAGTATGACGTGATGCTCCTCGTTGGCTTGGGAATCGGA
GCTACACCTTTTATCAGCATCTTAAAGGACATGCTCAACAACATCAAATCCACGGAGCAACA
CAAGCCGTTTGATAGCCCGAGAAGAAAGAGCCGCAAGTCTCGTGGCCCAACAAACGCC
TACTTCTACTGGGTCACCAGAGAGCAAGGCTCGTTCGAGTGGTTCAAAGGCGTCATGAATGAGGTGGCCGAAATAGATCACAAG
GCAGTAATTGAGATGCACAACTACCTCACAAGCGTG
TACGAGGAAGGTGACGCGCGCTCGGCTCTCATTGCAATGGTACAAGCTCTACACCACACCAAAAACGGCGTGGATATCGTCTCGGGCACCCGG
GCACGCACTCACTTCGCAAGGCCAAAC
TGGGACAAGGTGTTCGCACGTCTCACTGCCACACACGACAATTCAAGGATAG
GAGTGTTCTACTGCGGGCCTTCGCAAGTCGCCAAAGAGTTAGATGTGCTGTCCCGGAAATATTCCCAA
GAGTCCAACACCAAATTTATATTCCACAAGGAGAACTTTTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCGATT CCAAGGAATT TGCGGAGTTG CTGTTTGATG CTCTAGCCCG GCGGAAAGGC CATGACGAGC TGTGGACCGC TTCGAAGGAA GAACTCCGGG ACTTTTGGCT TCAAATCACG  GACAAGAGAT TTAGCTCTCG ATTGCAAACA TTTTTTGACT TGTGTGACAC GGATCTGGAC GGTCGCATAT CAGAAAACGA AGTGAAAGAG ATAATTCTAC TCAGTGCGTC GGCGAACAAG  CTCTCGTTTC TGCAAGAGCA AGCTGAAGAA TACGCAGCTC TCATCATGGG AGAACTCGAT CAGAATAAAC AAGGATATAT TGAGGTGAAA CAACTTGAAC GGTTGATGCG AGAGCCGATC  GCACTCGCTG AGGATCCGTC CTATGGGTAC GCGTGTGCTC CAACTTTACA CTCTCGAAGA AGAAACCGAT TGCATTTACT CCAGAGAACG ATCAAGTACT TCGCTCTGGA CAACTGGCAG  CGGATATGGG TGCTGTGCGT GTGGTTTCTC GCCATGACCG GTCTTTTCAC CTGGAAGTTC ATAGAGTACA AGAACAGAGC CGCTTTTAAG ATCATGGGAT ACTGTGTGTG CACGGCCAAA  GGCGCTGCGG AGACTTTGAA ACTCAACATG GCATTGGTCC TGCTGCCAGT TTGCAGGATC ACAATCACGT CCTTACGCTC CACTGTTTTC GGATCCATAC TACCTTTCAA CGACAACATC  AACTTTCACA AGCTTATTGC TGCAGCGATT TTGTTCGGCG TTTTGCTTCA CGGAGGAACT CATATTGCTT GTGACTTCCC CAAGATGGCC AACGCAAACA GTCGTATATT TCTTGATACT  ATTGGGCATG GTTTCCACGG CCGGCAACCA TCTTTCCTTG GCATATTGGC TTCGATTGAG GGGATTACGG GGATTATTAT GGTGGTCCTG ATGTCGATAG CTTTCCTTCT TGCAACGCAC  TGGTCCCGCA AGAACATCGT CAGGCTCCCT TGGCCCCTCC ACAGGTTAAC AGGATTCAAC GCATTTTGGT ACTCGCATCA TCTTTTTATT TTGGTCTACG CCCTGCTGAT CATACACTCG  GTGTTTCTCT TCCTGACCCC AGACTGGCAG CAAAAGACGA CGTGGATATA TCTATCCTGT CCATTGCTGC TGTACGTTGG CGAGAGGTTC CTGCGCGTTT TAAGATCGAG GCAGCATCGA  GTCAACATAG TAAAGGCAGC AATTCATCCT GGCAACGTTC TTGCCTTGGA CATGACAAAA CCTCCAGGCT TCAAGTATCG GAGTGGCATG TACATGTTTC TGCAGTGTCC AGCGATCTCG  CCATTCGAGT GGCATCCCTT CTCGATCACG TCTGCGCCCG ACGACGAGTT TTTAAATGTG CACATACGGA CGGTGGGGGA CTGGACCAAG GAAATGAGGA AAATCTTTGC CAAGTCCGCG  GCTGGCTGGC TTACATCCCC TGACAGGTTT CCAAAGCTCT ACATTGATGG ACCTTATGGC GCTCCTGCTC AGGACTACCG AAAGTATGAC GTGATGCTCC TCGTTGGCTT GGGAATCGGA  GCTACACCTT TTATCAGCAT CTTAAAGGAC ATGCTCAACA ACATCAAATC CACGGAGCAA CACAAGCCGT TTGATAGCCC GAGAAGAAAG AGCCGCAAGT CTCGTGGCCC AACAAACGCC  TACTTCTACT GGGTCACCAG AGAGCAAGGC TCGTTCGAGT GGTTCAAAGG CGTCATGAAT GAGGTGGCCG AAATAGATCA CAAGGCAGTA ATTGAGATGC ACAACTACCT CACAAGCGTG  TACGAGGAAG GTGACGCGCG CTCGGCTCTC ATTGCAATGG TACAAGCTCT ACACCACACC AAAAACGGCG TGGATATCGT CTCGGGCACC CGGGCACGCA CTCACTTCGC AAGGCCAAAC  TGGGACAAGG TGTTCGCACG TCTCACTGCC ACACACGACA ATTCAAGGAT AGGAGTGTTC TACTGCGGGC CTTCGCAAGT CGCCAAAGAG TTAGATGTGC TGTCCCGGAA ATATTCCCAA 
GAGTCCAACA CCAAATTTAT ATTCCACAAG GAGAACTTTT AG 

Retrieve as FASTA