Entry information : SmRboh04-1_39 (SmRboh04a_39)
Entry ID 6093
Creation 2008-02-08 (Christophe Dunand)
Last sequence changes 2010-06-01 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmRboh04-1_39 (SmRboh04a_39)
Name (synonym) SmRboh04-1_39 (SmRboh04a_39)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmRboh04-1_39
start..stop
S start..stop
SmRboh04-2_88 1551 0 1..788 1..789
SmRboh03-2_66 1019 0 1..788 16..796
SmRboh02-1_19 987 0 33..788 128..895
SmRboh02-2_137 986 0 15..788 112..902
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 96633..96864 232 N° 2 96918..97077 160 N° 3 97138..97186 49 N° 4 97252..97365 114
N° 5 97422..97826 405 N° 6 98778..99164 387 N° 7 99223..99318 96 N° 8 99373..99488 116
N° 9 99545..99681 137 N° 10 99731..99761 31 N° 11 99796..99955 160 N° 12 100022..100183 162
N° 13 100248..100376 129 N° 14 100437..100625 189  
join(96633..96864,96918..97077,97138..97186,97252..97365,97422..97826,98778..991 64,99223..99318,99373..99488,99545..99681,99731..99761,99796..99955,100022..1001 83,100248..100376,100437..100625)


exon

Literature and cross-references SmRboh04-1_39 (SmRboh04a_39)
DNA ref. Phytozome 11:   scaffold_39 (96633..100625)
mRNA ref. JGI transcript:   110111 [Incorrect splicing]
EST ref. GenBank:   FE471911.1 [3' end]   FE471912.1 [Fragment]
Protein sequence: SmRboh04-1_39 (SmRboh04a_39)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   560
PWM (Da):   %s   59430.43 Transmb domain:   %s   i235-257o321-343i371-393o419-441i598-615o
PI (pH):   %s   7.81
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPVDFSPDREPPAAAAAAAAAAAPPAIATTSRAIEGLRFIDKSNRDTNWETVDARFRKLSAGRPDGRLARSDFGACIGMKTKEFAGQLFDALSRRRGKEGLTSIGREELSDYWLDMTDKRFDSRMRIFFDLCDKDLDGRIFEDEVKVILLSASANRLSILEEQAEEYAALIMEELDREKNGYIGLLQLEGLLRSPSACDHQSQMISSSATLPKSAIGRMESLRRRARVVLLDDWQRVWMIALWFAVMAVLFSWKFIQYSYRSGFPVMGYCLCTAKGAAETLKLNMALILLPVCRNTITWLRSTALATIVPFDDNINFHKLVAVAIVIGVFLHGGVHLTCDFYRISSADYIKFIQTLGVNFKFAQPTYLDLVLSIEGMTGIIMVLLMIIAFLLATHWSRRNLVKLHWPFHRLTGFNAFWYSHHLFVLVYGLLIVHSIFLFLARGWREKTAWMYIAIPALLYTGERTLRTLRACTYKVSIVKASIYSGNVLALYMTKPPGFRYQSGMYLFLQCPAVSPFEWHPFSITSAPGDEYVSVHIRSLGDWTQELMKIFSQVSFSGERFHGFILAFRMISKVYPKLCVDGPYGAPSQDFKKYDILLLVGLGIGATPFISILRDMLNHLKSAEQLGSQSPFSKMFDAARKKAKKNRGPTNAYFYWVTREQSSFEWFKGVMNEVSQLDHKAVIEMHNYLTSVYEEGDARSTLIGLVQALHHARSGVDIVSGTRVRTHFARPNWRKVFARLASIHPGARIGVFYCGNSAAGKELDLLSRSYSEKSNTKFIFHKEKF*

Retrieve as FASTA  
Remarks Complete sequence from genomic (12 introns) and 2 ESTs. Incorrect prediction from JGI (splicing error confirmed with EST)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCAGTGGATTTCTCGCCCGATCGAGAGCCCCCAGCAGCGGCGGCGGCGGCGGCGGCGGCGGCAGCTCCACCCGCGATCGCCACAACCAGTCGCGCGATCGAGGGGCTTCGCTTCATC
GACAAATCCAACCGCGACACGAATTGGGAGACGGTGGATGCGCGATTCCGGAAGCTCAGCGCTGGCAGGCCCGATGGGAGGCTGGCGAGATCGGATTTTGGGGCGTGTATAG
GTGAGCTC
TCTCTGTTCTTGGCTGGAATCTCTCTGATCGCTCGCTCGCTCCAGGGATGAAAACCAAGGAGTTTGCCGGGCAGCTCTTCGATGCATTGTCGCGGCGGCGAGGCAAGGAGGGATTGACGA
GCATTGGGCGAGAAGAGCTGAGCGATTACTGGCTCGACATGACGGACAAGCGCTTCGATTCGCGAATGCGCATCTTCTTCGACCT
GTAAGGCGCTGATTTCTTGCGATTTCTTCCTGTCG
CTGATGCGATCGTGCTGCCACGCAGCTGCGACAAGGATCTGGACGGGCGAATCTTCGAGGACGAGGTAAAAGAGGTAAGAACCTTTCTATCCCAGCAAATGCCGTGTCTGGGTATCTTGG
ACTGAGCGAGTGATTCCAGGTGATCTTGCTCAGCGCGTCCGCGAATCGGCTCTCGATCCTCGAGGAGCAGGCCGAGGAGTACGCGGCACTCATCATGGAGGAGCTGGATCGCGAGAAGAA
CGGCTACATTGGC
GTAAGATCATCACTCTTTCACCCATCCAAGCTTACGTGAATCTCTTGGATCTCCAGTTGCTCCAGCTCGAGGGACTGCTGCGAAGCCCCAGCGCCTGCGACCACCAG
AGCCAGATGATAAGCTCCTCGGCGACGCTGCCCAAGAGCGCGATCGGGAGGATGGAATCGCTGAGGCGGCGCGCGAGGGTGGTGCTCCTGGACGACTGGCAGCGCGTGTGGATGATCGCG
CTGTGGTTCGCGGTGATGGCGGTGCTCTTTAGCTGGAAGTTCATCCAGTATAGCTACCGCTCGGGGTTTCCAGTGATGGGCTACTGCCTGTGCACTGCCAAGGGCGCCGCCGAGACGCTC
AAGCTCAACATGGCGCTCATCCTTCTCCCGGTTTGCCGGAATACCATCACTTGGCTGAGATCCACCGCGCTCGCCACCATCGTTCCCTTCGACGATAACATCAACTTTCACAAG
GTTAGT
CTTCTCTCTCCTCTTTCGGTTCTCGTTTGCTTTGATCTTCGCCATAGCTGAGCATGTTTGTCCTACTAGCTTTTCTCTCTCTTTTGTTTTGCTTCCTTCTTCTTTGGGCTCTTTTTTTTT
TTGTTCTTTCTCGTTCTACCATAGTTTTCCTTGGGTTTGCAGTGTTTTTGTGTGAGAATTGTTTCTATTTGCTGCACTCTTGTCTAGATGGATCATATTTTGTTTTTCTGGCTCTCTCCA
TCACGTTTTTGTTCTTGATTCACATTTTTGCTGGCTGGATTGGATTAATGTTTTGCAACTTTGTTTTCCCTCTTTGTCTTCTGCAATATTTTTTTTGTCTTTCTCCTTCGCGAACGCTGC
TAACTGAGTTACTCCCACGCACATCTCCCTGATCATGTAAGCCAAGTTTTTCTTCCATGGCTGTCTGTTTTTTGTTTGGTTCTTCGTCACCGCGATGTGTCTCTCCTTTTGTTCCTTCTT
CTTCGCTGCGTCCATCTTTTGCAGTGGTTTGAGTTTTTTTGTTAAAGTTCTTCGCTAAATCTTCACTGTGCTACTGCCAGGAATTTTTTTTCACTACTTCCTGGCTTTTTGTTTTCACTC
TTCTGGTTGATTCTCTCCAGCTGGCTGCCTGTTGCTTGCTGGTCCCTGGTGTTTCTTTCCTTTGTGCCTTTATGCTTTTATTTTCTCTAGTTTCAATCAATCAGTTGATCATAATGTTCT
CCCTTGACTGATTGATTGTTCTTCGTGTGATCCTGACAGTGGAAAGCTAAAGTATTGTTTCGACCGTCTCTGGTACTTGGCTTGGGTAATGGGTGCTTTGTTGTATATGCCTTTCTTATA
CTTTTCGTTGCTTCATCGTCATCGCCATTGTCGTCTTTTTTGCATTGACGAATCTGAGCTTCTTACATGTTTTTTCTTCTTCTTTTTTTTTTTTCTGGAGATCAGCTGGTTGCAGTAGCA
ATCGTGATTGGAGTTTTCCTCCACGGGGGAGTTCACTTAACCTGCGATTTTTACCGGATTTCCAGCGCGGACTACATCAAGTTCATACAGACACTAGGCGTGAACTTCAAGTTTGCCCAG
CCGACGTACCTGGATTTGGTGCTTTCGATCGAGGGAATGACCGGGATTATCATGGTGCTGCTCATGATCATCGCGTTTTTGCTGGCCACGCACTGGTCGAGGAGAAATCTCGTCAAGCTC
CACTGGCCATTCCACAGGTTGACGGGCTTCAATGCCTTTTGGTACTCGCACCACTTGTTCGTCCTCGTCTACGGTCTTCTCATCGTTCACTCCATTTTCTTGTTCCTCGCTCGGGGCTGG
AGAGAAAAAACG
GTAAATCACTTTTATTTTCTTCTTTGTGTCTCGTTGTTCTAAAGCTTTTCCTTCACAGGCTTGGATGTATATAGCTATACCCGCGCTCTTGTACACTGGCGAGAGGAC
TCTGCGAACGCTGAGAGCTTGTACTTACAAAGTTAGCATTGTAAAG
GTAAACAAAGATGGAATTTTTGTCCAGTTTTGCTCACGATTTGCGATCTTTCAGGCATCCATTTATTCAGGAAA
CGTTCTTGCTTTATACATGACTAAGCCTCCGGGTTTTAGATATCAAAGTGGAATGTATCTCTTCTTGCAATGCCCCGCGGTGTCGCCCTTCGAATG
GTAAGCTAGATTTGTGTATGTGTG
GTTCGTTTCTTAAGGATTTGTCCGTGTTACAGGCATCCATTCTCCATAACTTCGGCACCGGGAGATGAATATGTAAGTGTACACATACGCAGCCTCGGGGATTGGACGCAAGAGCTAATG
AAGATCTTTTCTCAAGTAAGTTTTTCGGGAGAAAGATTTCATGGCTTAT
GTGCTTTTCTTGCAGGTTGTAGATCAGCCAAATGAGCAGCTCAAGTAAGTTATCTTAGCTTTTCGTATGAT
CTCTAAAGT
GTTTTCCTTTTTTTTTTATCTTTGTCTCGTGTAGATATCCCAAGCTCTGTGTTGATGGACCATATGGAGCACCATCCCAGGATTTCAAAAAGTATGATATCCTATTGCTGG
TGGGACTTGGAATTGGAGCAACACCATTTATAAGCATCCTGAGAGACATGTTGAATCATTTAAAGTCAGCCGAACAGCTTCCT
GTAAGTATTTTATCTTCTTTTCTTTTTTCCTCCAGAA
GCAATGAACTTACACACATTATCTTCCAGGGATCTCAAAGTCCATTCAGCAAGATGTTCGATGCTGCCAGAAAAAAAGCCAAGAAAAATAGAGGCCCTACGAACGCTTACTTCTACTGGG
TCACCAGAGAGCAAAGCTCCTTTGAATGGTTCAAGGGAGTCATGAACGAAGTCTCTCAGCTTGATCACAAG
GTCAGGAAAACGTTTGTGATTTCTATCTCCTCCTTTTACAAATCGTTTT
GGTGCTTCTTTGCAGGCCGTGATCGAGATGCATAACTATCTAACGAGTGTTTACGAAGAAGGAGACGCTCGCTCCACGCTTATCGGTTTGGTCCAAGCGTTGCATCACGCACGAAGCGGT
GTTGATATTGTCTCTGGCACTCGG
GTAAGTTCCTTTCTAGTTAATGTTCTTTCTTCTTATTTGTTCTTTCGATTTCTTCCCCAGGTTCGAACGCATTTTGCTCGTCCAAACTGGAGGAAA
GTGTTTGCGAGGCTTGCATCGATTCATCCAGGTGCCAGAATAGGTGTGTTTTACTGCGGAAACTCGGCAGCAGGAAAGGAGCTCGACCTTCTCTCGCGGTCTTACTCGGAGAAATCAAAT
ACCAAGTTCATTTTCCACAAGGAAAAGTTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCAGTGGATTTCTCGCCCGATCGAGAGCCCCCAGCAGCGGCGGCGGCGGCGGCGGCGGCGGCAGCTCCACCCGCGATCGCCACAACCAGTCGCGCGATCGAGGGGCTTCGCTTCATC
GACAAATCCAACCGCGACACGAATTGGGAGACGGTGGATGCGCGATTCCGGAAGCTCAGCGCTGGCAGGCCCGATGGGAGGCTGGCGAGATCGGATTTTGGGGCGTGTATAG
GGATGAAA
ACCAAGGAGTTTGCCGGGCAGCTCTTCGATGCATTGTCGCGGCGGCGAGGCAAGGAGGGATTGACGAGCATTGGGCGAGAAGAGCTGAGCGATTACTGGCTCGACATGACGGACAAGCGC
TTCGATTCGCGAATGCGCATCTTCTTCGACCT
CTGCGACAAGGATCTGGACGGGCGAATCTTCGAGGACGAGGTAAAAGAGGTGATCTTGCTCAGCGCGTCCGCGAATCGGCTCTCGATC
CTCGAGGAGCAGGCCGAGGAGTACGCGGCACTCATCATGGAGGAGCTGGATCGCGAGAAGAACGGCTACATTGGC
TTGCTCCAGCTCGAGGGACTGCTGCGAAGCCCCAGCGCCTGCGAC
CACCAGAGCCAGATGATAAGCTCCTCGGCGACGCTGCCCAAGAGCGCGATCGGGAGGATGGAATCGCTGAGGCGGCGCGCGAGGGTGGTGCTCCTGGACGACTGGCAGCGCGTGTGGATG
ATCGCGCTGTGGTTCGCGGTGATGGCGGTGCTCTTTAGCTGGAAGTTCATCCAGTATAGCTACCGCTCGGGGTTTCCAGTGATGGGCTACTGCCTGTGCACTGCCAAGGGCGCCGCCGAG
ACGCTCAAGCTCAACATGGCGCTCATCCTTCTCCCGGTTTGCCGGAATACCATCACTTGGCTGAGATCCACCGCGCTCGCCACCATCGTTCCCTTCGACGATAACATCAACTTTCACAAG
CTGGTTGCAGTAGCAATCGTGATTGGAGTTTTCCTCCACGGGGGAGTTCACTTAACCTGCGATTTTTACCGGATTTCCAGCGCGGACTACATCAAGTTCATACAGACACTAGGCGTGAAC
TTCAAGTTTGCCCAGCCGACGTACCTGGATTTGGTGCTTTCGATCGAGGGAATGACCGGGATTATCATGGTGCTGCTCATGATCATCGCGTTTTTGCTGGCCACGCACTGGTCGAGGAGA
AATCTCGTCAAGCTCCACTGGCCATTCCACAGGTTGACGGGCTTCAATGCCTTTTGGTACTCGCACCACTTGTTCGTCCTCGTCTACGGTCTTCTCATCGTTCACTCCATTTTCTTGTTC
CTCGCTCGGGGCTGGAGAGAAAAAACG
GCTTGGATGTATATAGCTATACCCGCGCTCTTGTACACTGGCGAGAGGACTCTGCGAACGCTGAGAGCTTGTACTTACAAAGTTAGCATTGTA
AAG
GCATCCATTTATTCAGGAAACGTTCTTGCTTTATACATGACTAAGCCTCCGGGTTTTAGATATCAAAGTGGAATGTATCTCTTCTTGCAATGCCCCGCGGTGTCGCCCTTCGAATGG
CATCCATTCTCCATAACTTCGGCACCGGGAGATGAATATGTAAGTGTACACATACGCAGCCTCGGGGATTGGACGCAAGAGCTAATGAAGATCTTTTCTCAAGTAAGTTTTTCGGGAGAA
AGATTTCATGGCTTAT
TTATCTTAGCTTTTCGTATGATCTCTAAAGTATATCCCAAGCTCTGTGTTGATGGACCATATGGAGCACCATCCCAGGATTTCAAAAAGTATGATATCCTATTG
CTGGTGGGACTTGGAATTGGAGCAACACCATTTATAAGCATCCTGAGAGACATGTTGAATCATTTAAAGTCAGCCGAACAGCTTCCT
GGATCTCAAAGTCCATTCAGCAAGATGTTCGAT
GCTGCCAGAAAAAAAGCCAAGAAAAATAGAGGCCCTACGAACGCTTACTTCTACTGGGTCACCAGAGAGCAAAGCTCCTTTGAATGGTTCAAGGGAGTCATGAACGAAGTCTCTCAGCTT
GATCACAAG
GCCGTGATCGAGATGCATAACTATCTAACGAGTGTTTACGAAGAAGGAGACGCTCGCTCCACGCTTATCGGTTTGGTCCAAGCGTTGCATCACGCACGAAGCGGTGTTGAT
ATTGTCTCTGGCACTCGG
GTTCGAACGCATTTTGCTCGTCCAAACTGGAGGAAAGTGTTTGCGAGGCTTGCATCGATTCATCCAGGTGCCAGAATAGGTGTGTTTTACTGCGGAAACTCG
GCAGCAGGAAAGGAGCTCGACCTTCTCTCGCGGTCTTACTCGGAGAAATCAAATACCAAGTTCATTTTCCACAAGGAAAAGTTCTAG

Retrieve as FASTA