Entry information : CgNOx02
Entry ID 6111
Creation 2008-02-21 (Christophe Dunand)
Last sequence changes 2010-09-30 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-24 (Catherine Mathe (Scipio))
Peroxidase information: CgNOx02
Name CgNOx02
Class Ancestral NADPH oxidase    [Orthogroup: NOx001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Chaetomiaceae Chaetomium
Organism Chaetomium globosum    [TaxId: 38033 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CgNOx02
start..stop
S start..stop
NcNOx02 1097 0 3..583 2..581
MgrNOx02 1055 0 15..583 14..582
GzNOx02 1019 0 20..583 5..570
GmoNOx02 1007 0 22..583 7..572
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 88426..88625 200 N° 2 88679..90196 1518 N° 3 90254..90287 34  
join(88426..88625,88679..90196,90254..90287)


exon

Literature and cross-references CgNOx02
Literature Birren,B., Lander,E., Galagan,J., Devon,K., Nusbaum,C., Ma,L.-J., Jaffe,D., Butler,J., Alvarez,P., Gnerre,S., Grabherr,M., Kleber,M., Mauceli,E., Brockman,W., Rounsley,S., Young,S., LaButti,K., Pushparaj,V., DeCaprio,D., Crawford,M., Koehrsen,M., Engels,R., Montgomery,P., Pearson,M., Howarth,C., Kodira,C., Yandava,C., Zeng,Q., Alvarado,L., Oleary,S. and Untereiner,W. The Broad Institute Genome Sequencing Platform. Annotation of the Chaetomium globosum CBS 148.51 Genome
Protein ref. UniProtKB:   Q2GQZ5
DNA ref. JGI genome:   scaffold_7 (88426..90287)
mRNA ref. GenBank:   XM_001227535
Protein sequence: CgNOx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   583
PWM (Da):   %s   66551.58 Transmb domain:   %s   i67-89o104-126i147-169o184-206i227-249o259-281i421-443o
PI (pH):   %s   9.18
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASYGGYDGYGGGNRSSSGSLKQSERSRWTPLTRMLLSGEMTQEKQKELTPREKFDRWMVNEGYRRIFVFVFMILHATVFAFSFVHYALKDSLQIARDTFGPTFMIARAAALVLHVDVALILFPVCRTLISLARQTPLNGIIQFDKNITFHITTAWSIFFFSWVHTIAHWNNFAQIAAKNNLGFYGFLLANLASGPGWTGYVMLIALTGMVITSVEKTRRANYERFWYTHHMFIVFFFFWSIHGAFCMIQSDFAPFCSSIGTSAIGVFWQYWMYGGFAYLAERIAREIRGRHKTYISKVIQHPSNVCEIQIKKEHTKTRAGQYIFFCCPAVSLWQYHPFTLTSAPEEDYISIHMRVVGDFTRSVAETLGCEFDKKKGESSKVVGVNQDNDEVDPALRRVLPRVYIDGPFGSASEDVFKYEVSVLCGAGIGVTPFASILKSIWYRMNYPQKKTRLSKVYFFWICRDFGSFEWFRSLLLAIEAQDVDNRIEIHTYLTAKIKVDDATNIMINDANADKDTITGLRSPTNFGRPNWDMIFRGIRKLHTPSEAGVFFCGPKGLGSTLHIFCNKYSEPGFNFVWGKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns). Strain="ATCC 6205 / CBS 148.51 / DSM 1962 / IFO 6347 / NRRL 1970".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGCTACGGAGGATACGACGGCTACGGCGGCGGCAACCGCAGTAGCTCGGGCTCACTAAAGCAGTCGGAAAGGTCGAGATGGACGCCCCTCACGCGGATGTTGCTATCGGGTGAG
ATGACGCAGGAGAAACAAAAAGAGTTGACGCCACGAGAAAAGTTCGACCGATGGATGGTGAACGAAGGCTACCGTCGAAT
GTGGGTTTTGGTTTGTCGCTTCTTGATAACCCCGTGCTGA
CTCTCCGCTACAGTTTTGTCTTTGTATTCATGATACTCCATGCGACCGTGTTCGCCTTCAGTTTTGTCCACTACGCGCTCAAGGACAGTCTGCAGATTGCGCGCGACACTTTCGGGCCGA
CATTCATGATCGCGCGTGCCGCGGCGCTCGTTCTCCACGTTGATGTCGCGCTGATCCTGTTCCCAGTCTGCCGCACCCTCATCTCGCTGGCGAGGCAGACACCGCTCAACGGCATCATCC
AGTTCGACAAGAACATCACATTTCACATTACCACAGCGTGGTCCATCTTCTTTTTCTCCTGGGTACACACGATTGCCCATTGGAACAACTTTGCCCAGATCGCAGCGAAGAACAACCTGG
GGTTTTATGGGTTCCTGTTGGCCAACCTCGCGTCCGGGCCGGGCTGGACGGGTTATGTTATGCTCATTGCCTTGACGGGCATGGTCATCACCTCGGTTGAGAAGACGCGGCGCGCCAATT
ACGAGCGGTTCTGGTATACGCACCACATGTTCATCGTTTTCTTTTTCTTCTGGTCGATCCACGGCGCCTTCTGCATGATCCAGTCCGATTTTGCGCCCTTTTGCAGCTCGATCGGCACCT
CGGCCATCGGCGTCTTCTGGCAGTACTGGATGTACGGTGGCTTCGCCTATCTTGCCGAGCGTATTGCCCGCGAGATCCGCGGCAGGCACAAGACGTACATCTCCAAGGTCATCCAGCACC
CGAGCAACGTTTGCGAAATCCAGATCAAGAAGGAGCACACCAAGACAAGAGCTGGCCAGTACATCTTCTTCTGCTGCCCCGCGGTGTCATTGTGGCAATACCACCCCTTCACCTTGACCA
GCGCCCCGGAGGAAGACTACATCTCAATCCACATGCGTGTCGTGGGCGATTTCACCAGATCGGTTGCCGAGACACTCGGCTGCGAATTTGACAAGAAGAAGGGCGAGTCCTCCAAGGTGG
TGGGCGTCAACCAGGACAACGACGAAGTGGATCCCGCGCTCCGGCGGGTGCTGCCGCGTGTCTATATCGACGGACCGTTTGGCTCAGCGTCCGAGGACGTCTTCAAGTACGAGGTCTCGG
TTCTGTGCGGTGCCGGTATCGGTGTGACGCCGTTCGCGTCCATTCTCAAATCGATCTGGTACCGGATGAACTACCCGCAGAAAAAGACGCGGCTCAGCAAGGTGTACTTCTTCTGGATCT
GCAGAGACTTTGGGTCGTTCGAGTGGTTCCGCTCCCTGCTCCTCGCCATTGAGGCGCAGGACGTGGACAACCGCATTGAAATCCATACCTACCTGACGGCCAAGATCAAGGTTGACGATG
CGACGAACATCATGATCAACGACGCCAACGCGGACAAGGATACCATCACCGGCTTGCGGTCGCCGACCAACTTTGGTCGTCCCAATTGGGATATGATTTTCCGGGGTATCAGGAAACTAC
ACACCCCTTCTGAGGCTGGTGTGTTCTTCTGCGGTCCCAAGGGGTTGGGCAGTACATTACATATTTTCTGCAACAAGTACAGCGAGCCTGG
GTAAGTCAAAACAGCCTTTGCAACACGAT
TCCTGCTCGTGCTAACGGATGGCTTTAGGTTCAACTTTGTCTGGGGCAAGGAGAACTTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGCTACGGAGGATACGACGGCTACGGCGGCGGCAACCGCAGTAGCTCGGGCTCACTAAAGCAGTCGGAAAGGTCGAGATGGACGCCCCTCACGCGGATGTTGCTATCGGGTGAG
ATGACGCAGGAGAAACAAAAAGAGTTGACGCCACGAGAAAAGTTCGACCGATGGATGGTGAACGAAGGCTACCGTCGAAT
TTTTGTCTTTGTATTCATGATACTCCATGCGACCGTGTTC
GCCTTCAGTTTTGTCCACTACGCGCTCAAGGACAGTCTGCAGATTGCGCGCGACACTTTCGGGCCGACATTCATGATCGCGCGTGCCGCGGCGCTCGTTCTCCACGTTGATGTCGCGCTG
ATCCTGTTCCCAGTCTGCCGCACCCTCATCTCGCTGGCGAGGCAGACACCGCTCAACGGCATCATCCAGTTCGACAAGAACATCACATTTCACATTACCACAGCGTGGTCCATCTTCTTT
TTCTCCTGGGTACACACGATTGCCCATTGGAACAACTTTGCCCAGATCGCAGCGAAGAACAACCTGGGGTTTTATGGGTTCCTGTTGGCCAACCTCGCGTCCGGGCCGGGCTGGACGGGT
TATGTTATGCTCATTGCCTTGACGGGCATGGTCATCACCTCGGTTGAGAAGACGCGGCGCGCCAATTACGAGCGGTTCTGGTATACGCACCACATGTTCATCGTTTTCTTTTTCTTCTGG
TCGATCCACGGCGCCTTCTGCATGATCCAGTCCGATTTTGCGCCCTTTTGCAGCTCGATCGGCACCTCGGCCATCGGCGTCTTCTGGCAGTACTGGATGTACGGTGGCTTCGCCTATCTT
GCCGAGCGTATTGCCCGCGAGATCCGCGGCAGGCACAAGACGTACATCTCCAAGGTCATCCAGCACCCGAGCAACGTTTGCGAAATCCAGATCAAGAAGGAGCACACCAAGACAAGAGCT
GGCCAGTACATCTTCTTCTGCTGCCCCGCGGTGTCATTGTGGCAATACCACCCCTTCACCTTGACCAGCGCCCCGGAGGAAGACTACATCTCAATCCACATGCGTGTCGTGGGCGATTTC
ACCAGATCGGTTGCCGAGACACTCGGCTGCGAATTTGACAAGAAGAAGGGCGAGTCCTCCAAGGTGGTGGGCGTCAACCAGGACAACGACGAAGTGGATCCCGCGCTCCGGCGGGTGCTG
CCGCGTGTCTATATCGACGGACCGTTTGGCTCAGCGTCCGAGGACGTCTTCAAGTACGAGGTCTCGGTTCTGTGCGGTGCCGGTATCGGTGTGACGCCGTTCGCGTCCATTCTCAAATCG
ATCTGGTACCGGATGAACTACCCGCAGAAAAAGACGCGGCTCAGCAAGGTGTACTTCTTCTGGATCTGCAGAGACTTTGGGTCGTTCGAGTGGTTCCGCTCCCTGCTCCTCGCCATTGAG
GCGCAGGACGTGGACAACCGCATTGAAATCCATACCTACCTGACGGCCAAGATCAAGGTTGACGATGCGACGAACATCATGATCAACGACGCCAACGCGGACAAGGATACCATCACCGGC
TTGCGGTCGCCGACCAACTTTGGTCGTCCCAATTGGGATATGATTTTCCGGGGTATCAGGAAACTACACACCCCTTCTGAGGCTGGTGTGTTCTTCTGCGGTCCCAAGGGGTTGGGCAGT
ACATTACATATTTTCTGCAACAAGTACAGCGAGCCTGG
GTTCAACTTTGTCTGGGGCAAGGAGAACTTCTAG

Retrieve as FASTA