Entry information : GzNOx02
Entry ID 6112
Creation 2008-02-21 (Christophe Dunand)
Last sequence changes 2008-02-21 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: GzNOx02
Name GzNOx02
Class Ancestral NADPH oxidase    [Orthogroup: NOx001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Nectriaceae Gibberella
Organism Gibberella zeae (anamorph Fusarium graminearum)    [TaxId: 5518 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GzNOx02
start..stop
S start..stop
GmoNOx02 1132 0 1..570 1..572
CgNOx02 1019 0 7..570 22..583
NcNOx02 1014 0 6..570 18..581
MgrNOx02 998 0 5..570 19..582
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1293313..1293467 155 N° 2 1291716..1293239 1524 N° 3 1291629..1291662 34  
complement(join(1291629..1291662,1291716..1293239,1293313..1293467))


exon

Literature and cross-references GzNOx02
Literature Birren et al., The Broad Institute Genome Sequencing Platform
DNA ref. JGI genome:   Supercontig_3.8 (1293467..1291629)
mRNA ref. GenBank:   XM_390983
Protein sequence: GzNOx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   570
PWM (Da):   %s   65687.2 Transmb domain:   %s   i52-74o89-111i132-154o169-191i212-234o244-266i305-324o408-430i
PI (pH):   %s   9.03
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQDWSEKPSERSRWTPLTRMLLSGEMTQEKQQELSSREKFDRWMINEGYRRFFVFVFMILHALIFSFACVHYAQKESLETSRQTFGFTFIIARSAALVLHVDVAIILFPVCRTLISLLRQTPLNGILQFDKNITFHIVTAWSIVFWSWVHTIAHWNNFAQVAIKYNLGIYGWLLANFVSGPGWTGYVMLIALMGMVLTSMEKPRRANFERFWYTHHMFIVFFFFWSIHGAFCMIQPDVAPFCTSIGSSAIGVFWQFWMYSGFCYLAERIAREVRGRHRTFISKVIQHPSNVCEIQMKKEHTKTRAGQYIFLCCPAVSLWQYHPFTLTSAPEEDYISIHMRCVGDFTKELAKSLGCDWSKKKDAGDASKVVGLTGREAEIDPAIRRVLPRVYVDGPFGSASEDVFKYEVSVLVGAGIGVTPFASILKSIWYRMNYPQKKTRLSKVYFFWICRDFDSFEWFRSLLLAVEAQDLDHRIEIHTYLTARIKADDATNIMINDANADKDTITGLRSPTNFGRPNWDMIFRGIRKIHSPAEAGVFYGGPKGLGSSLHTYCNKYTEPGFSFVWGKENF

Retrieve as FASTA  
Remarks complete sequence from genomic (chromo 3, 2 introns). Strain="PH-1; NRRL 31084".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGGATTGGTCCGAGAAACCGTCGGAACGATCGCGATGGACTCCCCTCACGCGCATGCTTCTTTCTGGTGAGATGACCCAGGAGAAGCAACAGGAACTGTCGTCAAGAGAAAAGTTT
GATCGCTGGATGATCAACGAGGGTTACCGAAGATT
GTAAGTCCAAGAATCACATGCCGAATGGTTAAGATGGTCTAGTTCACATGGGTTACTAACTTCATTACTCAAGCTTCGTCTTTGT
CTTTATGATTCTGCACGCCCTCATCTTCTCTTTCGCTTGCGTGCACTACGCTCAGAAGGAAAGTCTCGAAACTTCACGACAGACGTTTGGCTTCACTTTCATCATTGCTCGTTCAGCCGC
GCTGGTTCTCCATGTCGATGTCGCCATTATTCTCTTCCCCGTGTGCCGAACTCTCATCTCTCTTCTGCGCCAGACGCCGCTTAATGGAATCCTCCAGTTCGACAAGAACATCACCTTTCA
CATCGTTACCGCCTGGTCCATCGTCTTCTGGTCCTGGGTCCACACCATTGCTCACTGGAACAACTTTGCCCAGGTCGCCATCAAGTACAACCTTGGTATCTACGGCTGGCTACTTGCCAA
CTTTGTATCTGGTCCGGGATGGACAGGTTACGTGATGCTCATTGCACTGATGGGCATGGTTCTTACGTCGATGGAGAAGCCCCGACGAGCAAACTTTGAGCGTTTCTGGTACACTCACCA
CATGTTCATTGTCTTCTTCTTCTTCTGGTCGATTCATGGAGCTTTCTGCATGATTCAGCCTGACGTTGCTCCCTTTTGTACCAGCATTGGATCGTCAGCCATTGGAGTCTTTTGGCAATT
CTGGATGTACAGTGGTTTCTGCTACCTGGCTGAGCGTATTGCGCGTGAGGTGCGAGGTCGTCACAGGACATTCATCTCCAAGGTCATCCAGCACCCCAGCAACGTTTGCGAGATCCAGAT
GAAGAAGGAGCACACCAAGACACGAGCTGGTCAATACATCTTCCTCTGCTGCCCAGCCGTGTCTCTCTGGCAGTACCACCCCTTTACTCTGACCAGCGCCCCCGAGGAGGACTACATCTC
CATCCACATGCGTTGCGTTGGTGACTTCACCAAGGAGCTTGCCAAGTCTCTGGGCTGTGATTGGAGCAAGAAGAAGGATGCTGGCGATGCTAGTAAGGTTGTCGGTCTTACAGGCCGCGA
GGCCGAAATCGACCCAGCTATCCGTCGTGTCCTCCCCAGAGTCTACGTCGACGGCCCCTTTGGTTCTGCCTCTGAAGATGTCTTCAAGTATGAAGTCTCTGTCCTCGTCGGTGCTGGTAT
CGGTGTGACACCCTTCGCCTCCATCCTCAAGTCCATCTGGTACCGAATGAACTACCCCCAGAAGAAGACACGACTGTCCAAGGTTTACTTCTTCTGGATTTGCCGTGACTTCGACTCGTT
CGAGTGGTTCCGTTCGCTTCTTCTCGCTGTCGAAGCTCAGGATCTGGACCACCGCATTGAGATTCACACATATCTCACCGCCAGAATCAAGGCCGACGATGCGACAAACATTATGATCAA
CGATGCCAACGCCGACAAGGATACCATCACTGGTCTTCGCAGCCCGACCAACTTTGGCCGACCCAACTGGGACATGATCTTCAGAGGTATCAGGAAGATTCACAGCCCTGCCGAGGCGGG
TGTGTTCTACGGTGGTCCCAAGGGACTTGGAAGTTCACTGCACACGTATTGTAACAAGTATACTGAGCCCGG
GTAAGTCTATACCATTTCATGTTGTTGTATATCATTATCTAACGTGTA
TACAGATTCTCTTTCGTCTGGGGCAAGGAGAATTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGGATTGGTCCGAGAAACCGTCGGAACGATCGCGATGGACTCCCCTCACGCGCATGCTTCTTTCTGGTGAGATGACCCAGGAGAAGCAACAGGAACTGTCGTCAAGAGAAAAGTTT
GATCGCTGGATGATCAACGAGGGTTACCGAAGATT
CTTCGTCTTTGTCTTTATGATTCTGCACGCCCTCATCTTCTCTTTCGCTTGCGTGCACTACGCTCAGAAGGAAAGTCTCGAAACT
TCACGACAGACGTTTGGCTTCACTTTCATCATTGCTCGTTCAGCCGCGCTGGTTCTCCATGTCGATGTCGCCATTATTCTCTTCCCCGTGTGCCGAACTCTCATCTCTCTTCTGCGCCAG
ACGCCGCTTAATGGAATCCTCCAGTTCGACAAGAACATCACCTTTCACATCGTTACCGCCTGGTCCATCGTCTTCTGGTCCTGGGTCCACACCATTGCTCACTGGAACAACTTTGCCCAG
GTCGCCATCAAGTACAACCTTGGTATCTACGGCTGGCTACTTGCCAACTTTGTATCTGGTCCGGGATGGACAGGTTACGTGATGCTCATTGCACTGATGGGCATGGTTCTTACGTCGATG
GAGAAGCCCCGACGAGCAAACTTTGAGCGTTTCTGGTACACTCACCACATGTTCATTGTCTTCTTCTTCTTCTGGTCGATTCATGGAGCTTTCTGCATGATTCAGCCTGACGTTGCTCCC
TTTTGTACCAGCATTGGATCGTCAGCCATTGGAGTCTTTTGGCAATTCTGGATGTACAGTGGTTTCTGCTACCTGGCTGAGCGTATTGCGCGTGAGGTGCGAGGTCGTCACAGGACATTC
ATCTCCAAGGTCATCCAGCACCCCAGCAACGTTTGCGAGATCCAGATGAAGAAGGAGCACACCAAGACACGAGCTGGTCAATACATCTTCCTCTGCTGCCCAGCCGTGTCTCTCTGGCAG
TACCACCCCTTTACTCTGACCAGCGCCCCCGAGGAGGACTACATCTCCATCCACATGCGTTGCGTTGGTGACTTCACCAAGGAGCTTGCCAAGTCTCTGGGCTGTGATTGGAGCAAGAAG
AAGGATGCTGGCGATGCTAGTAAGGTTGTCGGTCTTACAGGCCGCGAGGCCGAAATCGACCCAGCTATCCGTCGTGTCCTCCCCAGAGTCTACGTCGACGGCCCCTTTGGTTCTGCCTCT
GAAGATGTCTTCAAGTATGAAGTCTCTGTCCTCGTCGGTGCTGGTATCGGTGTGACACCCTTCGCCTCCATCCTCAAGTCCATCTGGTACCGAATGAACTACCCCCAGAAGAAGACACGA
CTGTCCAAGGTTTACTTCTTCTGGATTTGCCGTGACTTCGACTCGTTCGAGTGGTTCCGTTCGCTTCTTCTCGCTGTCGAAGCTCAGGATCTGGACCACCGCATTGAGATTCACACATAT
CTCACCGCCAGAATCAAGGCCGACGATGCGACAAACATTATGATCAACGATGCCAACGCCGACAAGGATACCATCACTGGTCTTCGCAGCCCGACCAACTTTGGCCGACCCAACTGGGAC
ATGATCTTCAGAGGTATCAGGAAGATTCACAGCCCTGCCGAGGCGGGTGTGTTCTACGGTGGTCCCAAGGGACTTGGAAGTTCACTGCACACGTATTGTAACAAGTATACTGAGCCCGG
A
TTCTCTTTCGTCTGGGGCAAGGAGAATTTCTAA

Retrieve as FASTA