Entry information : NcNOx02
Entry ID 6113
Creation 2008-02-21 (Christophe Dunand)
Last sequence changes 2008-02-21 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-25 (Catherine Mathe (Scipio))
Peroxidase information: NcNOx02
Name NcNOx02
Class Ancestral NADPH oxidase    [Orthogroup: NOx001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Sordariaceae Neurospora
Organism Neurospora crassa    [TaxId: 5141 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value NcNOx02
start..stop
S start..stop
CgNOx02 1104 0 19..581 22..583
MgrNOx02 1043 0 21..581 24..582
GzNOx02 1029 0 18..581 6..570
GmoNOx02 1021 0 18..581 6..572
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1210296..1210486 191 N° 2 1208693..1210213 1521 N° 3 1208597..1208630 34  
complement(join(1208597..1208630,1208693..1210213,1210296..1210486))


exon

Literature and cross-references NcNOx02
Literature Galagan,J.E. et al., The genome sequence of the filamentous fungus Neurospora crassa. Nature 422 (6934), 859-868 (2003).
Protein ref. UniProtKB:   A7UW98
DNA ref. JGI genome:   supercont10.7 (1210486..1208597)
mRNA ref. GenBank:   XM_001728304
Protein sequence: NcNOx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   581
PWM (Da):   %s   66694.78 Transmb domain:   %s   i64-86o101-123i144-166o181-203i224-246o256-278i317-336o419-441i
PI (pH):   %s   8.95
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSYGGYDLYRSNTDSSIEKPSERSRWTPLTRMLLSGEMTQERQKELSPREKFDRWMVNEGYRRIFVFVFMVLHAIVFAFGFVNYAVKDNLQIARDTFGPTYMIARSAALVLHVDVALVLFPVCRTLISLARQTPLNGIIQFDKNITFHITTAWSIFFWSWVHTIAHWNNFAQIAAKNNLGIYGWLLANFVSGPGWTGYIMLIALTGMVITSVEKTRRANYERFWYTHHMFIIFFFFWSIHGAFCMIQPDFAPFCISVGTTAIGVFWQYWMYGGFAYLAERIAREVRGKHKTYISKVVQHPSNVCEIQIKKENTKTRAGQYIFFCCPAVSLWQYHPFTLTSAPEEDYISIHVRVVGDFTRQLAETLGCEFDNKKKGDTSKVVGVSQENDEVDPALRRVLPRVYVDGPFGSASEDVFKYEVSVLVGAGIGVTPFASILKSIWYRMNYPQQKTRLSKVYFFWVCRDFGSFEWFRSLLLAIEAQDVDHRIEIHTYLTAKIKIDDATNIMINDANADKDTITGLRSPTNFGRPNWDMIFRGIRKLHAPGEAGVFFCGPKGLGSSLHIFCNKYSEPGFHFVWGKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 7, 2 introns). No EST. Strain="ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTTACGGAGGGTACGACCTGTACAGGTCGAACACGGATTCGTCGATCGAAAAGCCGTCAGAGAGGTCAAGATGGACGCCACTTACTCGCATGCTACTGTCGGGTGAAATGACGCAG
GAAAGGCAAAAGGAGCTGAGTCCAAGGGAAAAGTTCGACCGATGGATGGTCAACGAAGGCTATCGACGAAT
GTAAGCACAAACCTTTACTGTCCCTTGGACCGCCGATGGCTTGTTGGGA
CGAGGGAAGAGAATGGAATGCTGACTGTTACAGCTTCGTCTTCGTCTTTATGGTGCTCCACGCCATCGTCTTTGCCTTTGGCTTCGTTAACTACGCCGTCAAAGACAACCTACAAATAGC
GCGGGATACGTTTGGACCGACATATATGATTGCAAGATCGGCAGCGCTGGTTCTGCACGTCGATGTTGCCCTGGTCCTTTTCCCCGTCTGCCGAACGCTCATCTCGCTCGCAAGACAGAC
TCCTCTGAACGGCATCATCCAATTCGACAAGAACATTACCTTCCACATCACGACAGCATGGTCCATCTTCTTCTGGTCGTGGGTGCACACCATTGCCCACTGGAACAACTTTGCCCAGAT
TGCAGCCAAGAACAACCTCGGTATCTACGGCTGGCTGTTGGCCAACTTTGTCTCGGGCCCCGGTTGGACTGGCTATATCATGTTGATCGCGCTGACAGGTATGGTGATCACTTCGGTCGA
AAAGACAAGACGGGCGAACTACGAGCGGTTCTGGTACACACACCACATGTTCATCATCTTCTTCTTTTTCTGGTCCATCCACGGTGCCTTCTGCATGATCCAGCCCGACTTTGCGCCTTT
CTGCATTTCCGTCGGCACCACGGCCATCGGTGTGTTCTGGCAGTACTGGATGTACGGAGGATTTGCCTATCTCGCCGAGCGCATTGCCCGCGAGGTCCGTGGCAAGCACAAGACGTACAT
CTCCAAGGTTGTCCAGCACCCCAGCAACGTGTGCGAGATCCAGATCAAGAAGGAGAACACCAAGACCCGCGCCGGCCAGTACATCTTCTTTTGCTGCCCGGCTGTATCCCTGTGGCAGTA
CCATCCCTTCACCCTCACGAGCGCGCCAGAGGAGGACTACATCTCGATCCACGTACGTGTCGTTGGTGATTTTACCAGGCAACTTGCCGAGACTTTGGGGTGCGAATTCGACAACAAGAA
GAAGGGAGACACGTCCAAGGTCGTTGGCGTCAGCCAGGAGAACGACGAAGTTGATCCCGCTCTCCGCCGTGTTCTTCCCCGTGTGTACGTCGATGGACCGTTCGGCTCCGCCTCCGAAGA
CGTGTTCAAGTACGAGGTGTCCGTCCTGGTCGGCGCCGGTATCGGCGTGACCCCCTTCGCCTCCATCCTCAAGTCGATCTGGTATCGCATGAACTACCCGCAACAAAAGACGCGGCTGAG
CAAGGTGTACTTCTTCTGGGTCTGCAGAGATTTCGGCTCGTTCGAGTGGTTCCGCTCTCTGTTGTTGGCTATCGAGGCCCAAGATGTCGACCACCGCATCGAGATCCACACGTACCTGAC
GGCCAAGATCAAGATTGACGATGCGACCAACATCATGATCAATGATGCCAACGCCGATAAGGATACCATTACTGGCTTGAGGTCGCCGACGAACTTTGGCCGTCCGAACTGGGATATGAT
CTTTAGGGGTATCAGGAAATTGCATGCTCCGGGCGAGGCTGGCGTGTTCTTCTGCGGTCCCAAGGGACTGGGCAGCTCGCTGCACATCTTTTGCAACAAGTATAGTGAGCCTGG
GTAAGT
TCATGGTTCTTTTGTGGTGGACTTGCAACGGAAAGACCGCTAACATCTTGCATTAGTTTCCACTTTGTTTGGGGCAAGGAGAACTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTTACGGAGGGTACGACCTGTACAGGTCGAACACGGATTCGTCGATCGAAAAGCCGTCAGAGAGGTCAAGATGGACGCCACTTACTCGCATGCTACTGTCGGGTGAAATGACGCAG
GAAAGGCAAAAGGAGCTGAGTCCAAGGGAAAAGTTCGACCGATGGATGGTCAACGAAGGCTATCGACGAAT
CTTCGTCTTCGTCTTTATGGTGCTCCACGCCATCGTCTTTGCCTTTGGC
TTCGTTAACTACGCCGTCAAAGACAACCTACAAATAGCGCGGGATACGTTTGGACCGACATATATGATTGCAAGATCGGCAGCGCTGGTTCTGCACGTCGATGTTGCCCTGGTCCTTTTC
CCCGTCTGCCGAACGCTCATCTCGCTCGCAAGACAGACTCCTCTGAACGGCATCATCCAATTCGACAAGAACATTACCTTCCACATCACGACAGCATGGTCCATCTTCTTCTGGTCGTGG
GTGCACACCATTGCCCACTGGAACAACTTTGCCCAGATTGCAGCCAAGAACAACCTCGGTATCTACGGCTGGCTGTTGGCCAACTTTGTCTCGGGCCCCGGTTGGACTGGCTATATCATG
TTGATCGCGCTGACAGGTATGGTGATCACTTCGGTCGAAAAGACAAGACGGGCGAACTACGAGCGGTTCTGGTACACACACCACATGTTCATCATCTTCTTCTTTTTCTGGTCCATCCAC
GGTGCCTTCTGCATGATCCAGCCCGACTTTGCGCCTTTCTGCATTTCCGTCGGCACCACGGCCATCGGTGTGTTCTGGCAGTACTGGATGTACGGAGGATTTGCCTATCTCGCCGAGCGC
ATTGCCCGCGAGGTCCGTGGCAAGCACAAGACGTACATCTCCAAGGTTGTCCAGCACCCCAGCAACGTGTGCGAGATCCAGATCAAGAAGGAGAACACCAAGACCCGCGCCGGCCAGTAC
ATCTTCTTTTGCTGCCCGGCTGTATCCCTGTGGCAGTACCATCCCTTCACCCTCACGAGCGCGCCAGAGGAGGACTACATCTCGATCCACGTACGTGTCGTTGGTGATTTTACCAGGCAA
CTTGCCGAGACTTTGGGGTGCGAATTCGACAACAAGAAGAAGGGAGACACGTCCAAGGTCGTTGGCGTCAGCCAGGAGAACGACGAAGTTGATCCCGCTCTCCGCCGTGTTCTTCCCCGT
GTGTACGTCGATGGACCGTTCGGCTCCGCCTCCGAAGACGTGTTCAAGTACGAGGTGTCCGTCCTGGTCGGCGCCGGTATCGGCGTGACCCCCTTCGCCTCCATCCTCAAGTCGATCTGG
TATCGCATGAACTACCCGCAACAAAAGACGCGGCTGAGCAAGGTGTACTTCTTCTGGGTCTGCAGAGATTTCGGCTCGTTCGAGTGGTTCCGCTCTCTGTTGTTGGCTATCGAGGCCCAA
GATGTCGACCACCGCATCGAGATCCACACGTACCTGACGGCCAAGATCAAGATTGACGATGCGACCAACATCATGATCAATGATGCCAACGCCGATAAGGATACCATTACTGGCTTGAGG
TCGCCGACGAACTTTGGCCGTCCGAACTGGGATATGATCTTTAGGGGTATCAGGAAATTGCATGCTCCGGGCGAGGCTGGCGTGTTCTTCTGCGGTCCCAAGGGACTGGGCAGCTCGCTG
CACATCTTTTGCAACAAGTATAGTGAGCCTGG
TTTCCACTTTGTTTGGGGCAAGGAGAACTTCTAA

Retrieve as FASTA