Entry information : MgrNOx02
Entry ID 6114
Creation 2008-02-21 (Christophe Dunand)
Last sequence changes 2008-02-21 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: MgrNOx02
Name MgrNOx02
Class Ancestral NADPH oxidase    [Orthogroup: NOx001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Magnaporthaceae Magnaporthe
Organism Magnaporthe grisea (Pyricularia grisea)    [TaxId: 148305 ]
Cellular localisation N/D
Tissue types Appressorium
Conidia
Mycelium
Inducer Pathogen interaction
Repressor N/D
Best BLASTp hits
Perox score E-value MgrNOx02
start..stop
S start..stop
CgNOx02 1068 0 23..582 23..583
NcNOx02 1045 0 5..582 2..581
GzNOx02 1014 0 19..582 5..570
GmoNOx02 1011 0 24..582 9..572
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2251310..2251509 200 N° 2 2251122..2251244 123 N° 3 2249667..2251058 1392 N° 4 2249562..2249595 34
complement(join(2249562..2249595,2249667..2251058,2251122..2251244,2251310..2251 509))


exon

Literature and cross-references MgrNOx02
Literature REFERENCE 1 Dean,R.A., et al., The genome sequence of the rice blast fungus Magnaporthe grisea. Nature 434 (7036), 980-986 (2005).
REFERENCE 2 Egan,M.J., Wang,Z.Y., Jones,M.A., Smirnoff,N. and Talbot,N.J. Generation of reactive oxygen species by fungal NADPH oxidases is required for rice blast disease. Proc. Natl. Acad. Sci. U.S.A. (2007)
Protein ref. UniProtKB_Uniparc:   A4R870
DNA ref. JGI genome:   Supercontig_6.13 (2251509..2249562)
mRNA ref. GenBank:   XM_370044
Cluster/Prediction ref. UniGene:   Mgr.10105
Protein sequence: MgrNOx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   582
PWM (Da):   %s   66572.42 Transmb domain:   %s   i67-89o104-126i147-169o184-206i227-249o259-281i420-442o
PI (pH):   %s   9.19
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSGYGYGGGGGGFRDSYGSEKGQSERSRWTPLTRMLLSGEMTQERQKELTPREKFDRWMVNEGYRRFFVFVFMILHAMVFAFGFVNYAVKDNLQRARDTFGPTFMIARAAALVLHFDVALILFPVCRTFISLARQTPLNGIIQFDKNITFHITTAWSIVFFSWVHTVAHWNNFAQIAAQQKLGIYGWLLANFVSGPGWTGYVMLIALMGMVFTSVEKPRRANYERFWYTHHFFIVFFFFWSIHGAFCMIQPDFAPFCMSFGTSAIGVFWQFWMYGGFVYMAERIAREIRGKHKTYISKVIQHPSNVCEIQIKKEHTKTRAGQYIFFCCPEVSVWQYHPFTLTSAPEEDYISIHMRVVGDFTRGVSKALGCDWDRKGDASKVVGVNGENPDVDPALKRVLPRVYVDGPFGSASEDVFKYEIAVLCGAGIGVTPFASILKSIWYRMNYPQKKTRLAKVYFFWICRDFGSFEWFRSLLLAIEAQDVDNRIEIHTYLTAKIKADDATNIMINDANADKDAITGLRAPTNFGRPNWDMIFRGIRKLHTPAEAGVFFCGPKGLGSTLHIFCNKYSEPDFAFVWGKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 3 introns) and 30 ESTs and 1 mRNA. Strain="70-15".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGGATACGGCTACGGAGGAGGAGGAGGAGGATTCCGGGACAGCTACGGCTCCGAGAAGGGCCAGTCCGAACGGTCAAGATGGACGCCGCTAACACGGATGCTGCTTTCCGGAGAG
ATGACACAAGAGAGGCAGAAGGAACTTACGCCCAGGGAAAAGTTCGACAGGTGGATGGTTAACGAGGGTTACCGACGATT
GTACGGATGCGACTCCTGAACCCCATGCGACCTATTGATT
TCACCGGTGCTAACATTCGGCTCAGCTTCGTTTTCGTCTTCATGATACTCCACGCGATGGTGTTTGCTTTTGGTTTCGTCAACTATGCTGTCAAGGATAACTTGCAAAGGGCAAGAGACA
CCTTTGGTCCGACCTTCATGATTGCCAG
GTGTGTGCTCCTATATATGATCTAACTGACTGTTGAAGAATGCGTCTGACATGGCGATAACAGAGCTGCGGCGCTCGTTCTCCACTTCGATG
TCGCTCTCATCCTCTTTCCGGTTTGCCGTACATTTATTTCTCTTGCGCGTCAAACGCCTCTGAACGGCATTATCCAGTTTGACAAGAACATCACCTTTCACATTACTACCGCCTGGTCTA
TCGTATTCTTCAGCTGGGTCCATACCGTTGCCCATTGGAACAACTTTGCGCAGATCGCTGCGCAGCAGAAGCTCGGTATTTACGGATGGCTCCTCGCCAACTTCGTCTCCGGCCCCGGAT
GGACAGGCTACGTTATGTTGATCGCACTTATGGGAATGGTCTTCACCTCGGTCGAGAAGCCCCGTCGTGCCAACTACGAGCGATTCTGGTACACTCACCACTTCTTCATCGTTTTCTTCT
TCTTCTGGTCCATCCACGGTGCCTTCTGCATGATTCAGCCCGACTTTGCACCATTCTGCATGTCCTTCGGTACCTCGGCCATCGGTGTGTTCTGGCAGTTCTGGATGTACGGAGGCTTTG
TCTACATGGCCGAGCGTATCGCCCGTGAGATTCGTGGCAAGCACAAGACGTACATTTCCAAAGTTATCCAGCACCCCAGCAACGTGTGCGAGATTCAAATCAAGAAGGAGCACACCAAGA
CGAGGGCTGGACAGTACATCTTCTTCTGCTGTCCCGAGGTCTCGGTTTGGCAGTACCACCCGTTCACTCTCACTAGTGCCCCTGAGGAGGACTATATTTCGATCCACATGCGTGTTGTCG
GTGACTTCACTCGCGGGGTGTCAAAGGCTCTGGGCTGCGACTGGGACCGAAAGGGCGATGCTTCCAAGGTTGTTGGTGTCAACGGCGAGAACCCCGACGTCGACCCTGCTCTTAAGCGGG
TGCTTCCCCGTGTCTACGTTGATGGTCCCTTCGGCTCTGCTTCCGAGGACGTTTTCAAGTACGAGATTGCTGTTCTTTGCGGTGCTGGTATCGGTGTCACGCCTTTCGCCTCTATTCTCA
AGTCTATCTGGTACCGCATGAACTACCCGCAGAAGAAGACCCGTCTCGCCAAGGTCTACTTCTTTTGGATTTGCCGTGACTTTGGCTCTTTCGAGTGGTTCCGCTCCCTGCTTCTCGCCA
TTGAGGCTCAAGATGTCGACAACCGCATCGAGATTCACACCTACCTCACCGCAAAGATCAAGGCCGATGATGCTACTAACATCATGATCAACGATGCCAACGCCGACAAGGATGCCATTA
CTGGTCTCCGCGCGCCCACAAACTTCGGTCGTCCCAACTGGGACATGATCTTCAGGGGTATCAGGAAGCTACACACTCCGGCCGAAGCCGGTGTGTTCTTCTGCGGTCCCAAGGGTCTGG
GTAGCACATTGCATATTTTCTGCAACAAATACAGCGAGCCTGA
GTATGTCCCTACTCCCATAACTCCTTTCATCAGACGTCATGGTATCATGTTTACTGACTCGGCTTTTACAGCTTCGC
ATTCGTATGGGGCAAGGAGAATTTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGGATACGGCTACGGAGGAGGAGGAGGAGGATTCCGGGACAGCTACGGCTCCGAGAAGGGCCAGTCCGAACGGTCAAGATGGACGCCGCTAACACGGATGCTGCTTTCCGGAGAG
ATGACACAAGAGAGGCAGAAGGAACTTACGCCCAGGGAAAAGTTCGACAGGTGGATGGTTAACGAGGGTTACCGACGATT
CTTCGTTTTCGTCTTCATGATACTCCACGCGATGGTGTTT
GCTTTTGGTTTCGTCAACTATGCTGTCAAGGATAACTTGCAAAGGGCAAGAGACACCTTTGGTCCGACCTTCATGATTGCCAG
AGCTGCGGCGCTCGTTCTCCACTTCGATGTCGCTCTC
ATCCTCTTTCCGGTTTGCCGTACATTTATTTCTCTTGCGCGTCAAACGCCTCTGAACGGCATTATCCAGTTTGACAAGAACATCACCTTTCACATTACTACCGCCTGGTCTATCGTATTC
TTCAGCTGGGTCCATACCGTTGCCCATTGGAACAACTTTGCGCAGATCGCTGCGCAGCAGAAGCTCGGTATTTACGGATGGCTCCTCGCCAACTTCGTCTCCGGCCCCGGATGGACAGGC
TACGTTATGTTGATCGCACTTATGGGAATGGTCTTCACCTCGGTCGAGAAGCCCCGTCGTGCCAACTACGAGCGATTCTGGTACACTCACCACTTCTTCATCGTTTTCTTCTTCTTCTGG
TCCATCCACGGTGCCTTCTGCATGATTCAGCCCGACTTTGCACCATTCTGCATGTCCTTCGGTACCTCGGCCATCGGTGTGTTCTGGCAGTTCTGGATGTACGGAGGCTTTGTCTACATG
GCCGAGCGTATCGCCCGTGAGATTCGTGGCAAGCACAAGACGTACATTTCCAAAGTTATCCAGCACCCCAGCAACGTGTGCGAGATTCAAATCAAGAAGGAGCACACCAAGACGAGGGCT
GGACAGTACATCTTCTTCTGCTGTCCCGAGGTCTCGGTTTGGCAGTACCACCCGTTCACTCTCACTAGTGCCCCTGAGGAGGACTATATTTCGATCCACATGCGTGTTGTCGGTGACTTC
ACTCGCGGGGTGTCAAAGGCTCTGGGCTGCGACTGGGACCGAAAGGGCGATGCTTCCAAGGTTGTTGGTGTCAACGGCGAGAACCCCGACGTCGACCCTGCTCTTAAGCGGGTGCTTCCC
CGTGTCTACGTTGATGGTCCCTTCGGCTCTGCTTCCGAGGACGTTTTCAAGTACGAGATTGCTGTTCTTTGCGGTGCTGGTATCGGTGTCACGCCTTTCGCCTCTATTCTCAAGTCTATC
TGGTACCGCATGAACTACCCGCAGAAGAAGACCCGTCTCGCCAAGGTCTACTTCTTTTGGATTTGCCGTGACTTTGGCTCTTTCGAGTGGTTCCGCTCCCTGCTTCTCGCCATTGAGGCT
CAAGATGTCGACAACCGCATCGAGATTCACACCTACCTCACCGCAAAGATCAAGGCCGATGATGCTACTAACATCATGATCAACGATGCCAACGCCGACAAGGATGCCATTACTGGTCTC
CGCGCGCCCACAAACTTCGGTCGTCCCAACTGGGACATGATCTTCAGGGGTATCAGGAAGCTACACACTCCGGCCGAAGCCGGTGTGTTCTTCTGCGGTCCCAAGGGTCTGGGTAGCACA
TTGCATATTTTCTGCAACAAATACAGCGAGCCTGA
CTTCGCATTCGTATGGGGCAAGGAGAATTTCTAG

Retrieve as FASTA