Entry information : SmPrx09-1_40 (SmPrx09a_40)
Entry ID 6196
Creation 2008-06-26 (Christophe Dunand)
Last sequence changes 2008-06-26 (Christophe Dunand)
Sequence status complete
Reviewer Paula Nunes
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx09-1_40 (SmPrx09a_40)
Name (synonym) SmPrx09-1_40 (SmPrx09a_40)
Class Class III peroxidase    [Orthogroup: Prx045]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue types strobili (cone)
Whole plant
Inducers Carbon starvation
Cold stress
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx09-1_40
start..stop
S start..stop
SmPrx09-2_89 711 0 1..355 1..355
SmPrx01-1_122 452 1e-160 28..331 19..323
SmPrx01-2_114 450 6e-160 28..331 19..323
SmPrx27-1_10 340 9e-117 26..343 12..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 405828..406052 225 N° 2 405570..405764 195 N° 3 405348..405513 166 N° 4 404814..405295 482
complement(join(404814..405295,405348..405513,405570..405764,405828..406052))


exon

Literature and cross-references SmPrx09-1_40 (SmPrx09a_40)
Literature Richardson,P., Lucas,S., Rokhsar,D., Wang,M. and Lindquist,E.A. DOE Joint Genome Institute Selaginella moellendorffii EST project. Unpublished (2008)
DNA ref. Phytozome 11:   scaffold_40 (406052..404814)
mRNA ref. JGI transcript:   233271
EST ref. GenBank:   FE427388.1 [5' end]   FE460737.1 [3' end]
Protein sequence: SmPrx09-1_40 (SmPrx09a_40)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   355 (333)
PWM (Da):   %s   38933.8 (36677.6)  
PI (pH):   %s   7.66 (7.31) Peptide Signal:   %s   cut: 23 range:23-355
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASRCSSALLLVFSSVFAIVSSQQELLGKVEENFYEKTCPAAERIVRDVVTSHFGRNRTVPAGLLRLFFHDCFVQGCDGSILLDASEDGSVIEKEGLPNRNSVRGFDVIDDAKTRLERVCPGVVSCADIVALAGRDAVVLVGAPDFAMPTGRLDGRISRRSEADALLPAPFFNATQLKASFVQQNLTVEDLVHLSGGHTIGRSQCQFFSNRLYNFSGGSPDPLLNPSYRAELQRLCPQNSRPTDRVTLDRASEFNFDNSYYTNLVAKNGLLTSDAALTVDSETESIVRSFARDPDRFQLRFQRSLLKMSKLGLKSKANGEVRRRCNAINPKRMEEESSLVTAITDATTRALAFSK

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and 5 ESTs. Contigs also contains SmPrx08. Strain="Plant Delights".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCACGATGCTCAAGCGCTCTACTTTTGGTGTTTTCTTCTGTATTTGCCATTGTGAGTTCTCAGCAGGAACTTCTTGGCAAAGTGGAGGAGAACTTTTACGAGAAAACTTGTCCT
GCTGCGGAGCGCATTGTTCGCGATGTTGTCACTTCCCATTTCGGCAGGAACCGGACTGTTCCAGCGGGACTTCTTCGCTTGTTCTTCCACGACTGCTTTGTGCAA
GTATGATTGCTCTTC
TTTCGTTGATTACACTCGCATTGGTTCCTTGCCTGGATGTAACTACAGGGATGCGATGGATCCATCTTGTTGGATGCTTCGGAGGACGGCTCCGTCATTGAAAAGGAAGGTCTACCGAAC
AGGAACTCGGTTCGAGGATTTGATGTCATTGACGATGCCAAGACAAGGCTGGAGCGTGTATGTCCGGGTGTTGTTTCCTGCGCGGACATCGTGGCTCTAGCCGGAAGGGACGCAGTTGTC
CTG
GTAAGAAAGAGTTCTTAGTTCCATTCCATCACTCACTCTTGCATGCTTACGATCAGGTTGGAGCTCCAGACTTCGCTATGCCGACAGGACGTCTCGATGGAAGAATATCACGAAGGT
CGGAAGCTGATGCTCTTCTCCCGGCCCCTTTCTTCAACGCGACACAGCTCAAGGCTAGCTTCGTGCAGCAAAATCTCACCGTCGAGGACCTCGTCCACTTATCAG
GTACCGAAGTTTTTT
CTACTCCACAAATTTTCTTATCAACTTGCTCAAACAGGTGGTCACACTATTGGTAGATCACAGTGCCAGTTCTTTTCCAACAGGCTCTACAACTTCTCTGGAGGCAGCCCGGATCCACTC
CTCAACCCCTCCTACCGAGCAGAGCTGCAGCGCCTGTGTCCACAAAACTCTAGACCCACGGATCGAGTGACACTGGACCGAGCCTCGGAGTTTAACTTCGACAACAGTTACTACACAAAT
CTAGTCGCGAAGAATGGATTGCTCACGTCGGACGCGGCGCTCACAGTCGACAGCGAGACCGAGAGCATCGTGAGATCATTCGCGCGCGATCCCGACAGGTTCCAGCTGAGGTTCCAGAGA
TCTCTGTTGAAGATGAGCAAGCTCGGCCTCAAGAGCAAAGCGAATGGCGAAGTCCGGCGTCGTTGCAACGCAATCAATCCCAAGAGAATGGAGGAGGAGAGCTCGCTAGTCACTGCCATT
ACCGACGCTACAACTCGAGCTCTCGCCTTCTCCAAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCACGATGCTCAAGCGCTCTACTTTTGGTGTTTTCTTCTGTATTTGCCATTGTGAGTTCTCAGCAGGAACTTCTTGGCAAAGTGGAGGAGAACTTTTACGAGAAAACTTGTCCT
GCTGCGGAGCGCATTGTTCGCGATGTTGTCACTTCCCATTTCGGCAGGAACCGGACTGTTCCAGCGGGACTTCTTCGCTTGTTCTTCCACGACTGCTTTGTGCAA
GGATGCGATGGATCC
ATCTTGTTGGATGCTTCGGAGGACGGCTCCGTCATTGAAAAGGAAGGTCTACCGAACAGGAACTCGGTTCGAGGATTTGATGTCATTGACGATGCCAAGACAAGGCTGGAGCGTGTATGT
CCGGGTGTTGTTTCCTGCGCGGACATCGTGGCTCTAGCCGGAAGGGACGCAGTTGTCCTG
GTTGGAGCTCCAGACTTCGCTATGCCGACAGGACGTCTCGATGGAAGAATATCACGAAGG
TCGGAAGCTGATGCTCTTCTCCCGGCCCCTTTCTTCAACGCGACACAGCTCAAGGCTAGCTTCGTGCAGCAAAATCTCACCGTCGAGGACCTCGTCCACTTATCAG
GTGGTCACACTATT
GGTAGATCACAGTGCCAGTTCTTTTCCAACAGGCTCTACAACTTCTCTGGAGGCAGCCCGGATCCACTCCTCAACCCCTCCTACCGAGCAGAGCTGCAGCGCCTGTGTCCACAAAACTCT
AGACCCACGGATCGAGTGACACTGGACCGAGCCTCGGAGTTTAACTTCGACAACAGTTACTACACAAATCTAGTCGCGAAGAATGGATTGCTCACGTCGGACGCGGCGCTCACAGTCGAC
AGCGAGACCGAGAGCATCGTGAGATCATTCGCGCGCGATCCCGACAGGTTCCAGCTGAGGTTCCAGAGATCTCTGTTGAAGATGAGCAAGCTCGGCCTCAAGAGCAAAGCGAATGGCGAA
GTCCGGCGTCGTTGCAACGCAATCAATCCCAAGAGAATGGAGGAGGAGAGCTCGCTAGTCACTGCCATTACCGACGCTACAACTCGAGCTCTCGCCTTCTCCAAGTAA

Retrieve as FASTA