Entry information : SmPrx23-2_30 (SmPrx23b_30)
Entry ID 6204
Creation 2008-06-30 (Christophe Dunand)
Last sequence changes 2011-01-25 (Toky Ramarohetra (Scipio))
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-02-01 (Christophe Dunand)
Peroxidase information: SmPrx23-2_30 (SmPrx23b_30)
Name (synonym) SmPrx23-2_30 (SmPrx23b_30)
Class Class III peroxidase    [Orthogroup: Prx044]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx23-2_30
start..stop
S start..stop
SmPrx23-1_79 681 0 1..328 1..328
VvPrx31 354 7e-123 10..328 11..327
CpapPrx55 352 5e-122 13..328 11..325
PgPrx01 351 2e-121 7..324 8..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 555481..555714 234 N° 2 555797..555985 189 N° 3 556057..556222 166 N° 4 556310..556707 398
join(555481..555714,555797..555985,556057..556222,556310..556707)


exon

Literature and cross-references SmPrx23-2_30 (SmPrx23b_30)
Literature JGI
DNA ref. Phytozome 11:   scaffold_30 (555481..556707)
mRNA ref. JGI transcript:   235209
Protein sequence: SmPrx23-2_30 (SmPrx23b_30)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (304)
PWM (Da):   %s   36149.74 (33509.3) Transmb domain:   %s   i7-29o
PI (pH):   %s   9.21 (9.21) Peptide Signal:   %s   cut: 25 range:25-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEANFPRLGFIAILLLALVWISTAYQSYHPLKMGYYKCTRKCVNAEAIVKKIVRQYVKRDPTLAASLLRMHFHDCFVMGCDASILLNSTKTSIAERDALPNLSLRGFEVINAAKAALEAACPKTVSCADILSLAARDSVETIYGPSWDVPTGRRDGIISNASDVLLNLPPFFANFTTLKSIFAAKGLNVIDLVALSGGHTIGFSHCAAFDARLYNFTGKGDADPSLDPAYAAHLRTKCKHGDLVTKVPLDDTLTGFDTNYYKFIMQNKGLLQSDAALLETRRSRFLVEQSTKPSIFRPQFARSMTKMGRIEVLVEKQGQIRSRCEFVN

Retrieve as FASTA  
Remarks Warnings: Equal sequence : 6204;7010.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGCAAACTTCCCAAGGCTTGGATTCATTGCAATACTGCTGCTTGCACTGGTTTGGATTTCAACTGCTTATCAATCATATCATCCTCTCAAGATGGGATACTACAAATGCACAAGA
AAATGTGTCAATGCGGAGGCGATTGTCAAGAAGATTGTGAGGCAATATGTTAAAAGGGATCCAACGCTGGCTGCATCACTCTTGAGAATGCACTTCCATGATTGTTTCGTAATG
GTGAGT
TAACAAAGATTAACAACTTAGTGATTTAGATTCTCTTCCCATGGTTATAACTCAACTCTTTTGATGATTTATACAGGGATGCGATGCCTCTATTCTACTAAACTCTACCAAGACAAGCAT
TGCCGAGAGAGACGCACTCCCAAACTTGTCACTCAGAGGTTTCGAAGTGATCAATGCTGCAAAGGCTGCACTTGAAGCAGCGTGCCCCAAAACAGTATCTTGTGCTGATATTCTCTCCCT
CGCGGCTAGAGATTCAGTAGAAACG
GTACAGAAGTTTTTTATTTCTTATCTATCTCTCATAGTTTTCTAATAAACTTTTTTGATCCAATCACACAGATCTATGGACCTTCTTGGGACGTT
CCAACTGGCCGGAGAGATGGTATTATCTCCAATGCTTCAGACGTTCTCCTAAATCTTCCACCCTTCTTTGCCAATTTCACAACTCTCAAGTCCATCTTTGCTGCAAAAGGGTTGAATGTA
ATTGACCTTGTGGCACTCTCAG
GTAAGATAAATCTCACCTTCACCAACTTTTCGTTTACATTAGCATCTATACACACCTACACTTCTTAATTCCTCGTTTGACTTGCAGGTGGACACACT
ATTGGCTTTTCTCACTGTGCTGCTTTTGATGCCCGGCTCTACAATTTCACTGGGAAAGGTGATGCAGATCCATCTCTAGATCCTGCCTATGCAGCCCACCTTAGAACCAAGTGCAAGCAT
GGAGATCTTGTCACCAAGGTTCCCCTGGATGACACTCTCACAGGATTTGATACGAACTACTACAAGTTTATCATGCAAAACAAGGGGTTGCTCCAGTCCGATGCTGCACTCCTAGAGACT
CGAAGGTCGAGATTCCTGGTGGAGCAATCTACCAAGCCTTCGATCTTCAGGCCCCAGTTTGCACGATCCATGACTAAGATGGGGCGGATTGAGGTGCTCGTTGAAAAGCAGGGACAGATC
CGCAGTCGGTGTGAGTTTGTCAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGCAAACTTCCCAAGGCTTGGATTCATTGCAATACTGCTGCTTGCACTGGTTTGGATTTCAACTGCTTATCAATCATATCATCCTCTCAAGATGGGATACTACAAATGCACAAGA
AAATGTGTCAATGCGGAGGCGATTGTCAAGAAGATTGTGAGGCAATATGTTAAAAGGGATCCAACGCTGGCTGCATCACTCTTGAGAATGCACTTCCATGATTGTTTCGTAATG
GGATGC
GATGCCTCTATTCTACTAAACTCTACCAAGACAAGCATTGCCGAGAGAGACGCACTCCCAAACTTGTCACTCAGAGGTTTCGAAGTGATCAATGCTGCAAAGGCTGCACTTGAAGCAGCG
TGCCCCAAAACAGTATCTTGTGCTGATATTCTCTCCCTCGCGGCTAGAGATTCAGTAGAAACG
ATCTATGGACCTTCTTGGGACGTTCCAACTGGCCGGAGAGATGGTATTATCTCCAAT
GCTTCAGACGTTCTCCTAAATCTTCCACCCTTCTTTGCCAATTTCACAACTCTCAAGTCCATCTTTGCTGCAAAAGGGTTGAATGTAATTGACCTTGTGGCACTCTCAG
GTGGACACACT
ATTGGCTTTTCTCACTGTGCTGCTTTTGATGCCCGGCTCTACAATTTCACTGGGAAAGGTGATGCAGATCCATCTCTAGATCCTGCCTATGCAGCCCACCTTAGAACCAAGTGCAAGCAT
GGAGATCTTGTCACCAAGGTTCCCCTGGATGACACTCTCACAGGATTTGATACGAACTACTACAAGTTTATCATGCAAAACAAGGGGTTGCTCCAGTCCGATGCTGCACTCCTAGAGACT
CGAAGGTCGAGATTCCTGGTGGAGCAATCTACCAAGCCTTCGATCTTCAGGCCCCAGTTTGCACGATCCATGACTAAGATGGGGCGGATTGAGGTGCTCGTTGAAAAGCAGGGACAGATC
CGCAGTCGGTGTGAGTTTGTCAATTGA

Retrieve as FASTA