Entry information : SmKat01-2_44 (SmKat01b_44)
Entry ID 6214
Creation 2008-07-07 (Christophe Dunand)
Last sequence changes 2011-02-01 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-02-01 (Christophe Dunand)
Peroxidase information: SmKat01-2_44 (SmKat01b_44)
Name (synonym) SmKat01-2_44 (SmKat01b_44)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmKat01-2_44
start..stop
S start..stop
SmKat01-1_2 1008 0 1..492 1..492
AcvKat02 922 0 1..492 1..492
SmKat02-2_1 910 0 1..492 1..492
SmKat02-1_5 910 0 1..492 1..492
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 702801..702815 15 N° 2 702996..703092 97 N° 3 703172..703449 278 N° 4 703514..704290 777
N° 5 704336..704425 90 N° 6 704478..704545 68 N° 7 704609..704702 94 N° 8 704760..704819 60
join(702801..702815,702996..703092,703172..703449,703514..704290,704336..704425, 704478..704545,704609..704702,704760..704819)


exon

Literature and cross-references SmKat01-2_44 (SmKat01b_44)
Literature JGI
DNA ref. Phytozome 12:   scaffold_44 (702801..704819)
mRNA ref. JGI transcript:   178171
EST ref. GenBank:   DN837595.1 [5' end]   FE476532 [3' end]
Cluster/Prediction ref. UniGene:   Smo.309
Protein sequence: SmKat01-2_44 (SmKat01b_44)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   492
PWM (Da):   %s   56495.27  
PI (pH):   %s   7.79
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYKYRPSSAYNSAHFTTNTGAPVWNNNASLTVGSRGPILLEDYHLVEKLAQFDRERIPERVVHARGASAKGFFEVTHDVSHLTCADFLRAPGVQTPVIVRFSTVIHERGSPETLRDPRGFAVKFYTRGNFDMVGNNFPVFFVRDGMKFPDMVHALKPNPRTHIQENWRIMDFFSHHPESLHMFTFLLDDIGIPLNYRHMEGFGVHTFTLVNRAGKCSYVKFHWKPTCGVKSLLEEQAVIVGGSNHSHATQDLQDSIAAGNYPEWKLFIQTMEIKNENNYDFDPLDVTKTWPEDLFPLQPVGRLVLNKNIDNFFAENEQLAFCPALVVPGVYYTDDKLLQTRIFSYADTQRHRLGPNYLLLPANAPKCAHHNNHHEGFMNFTHRDEEVNYFPSRFDPCRHAERVPIPSHPLGGRREKVMIEKENNFAQPGARFRSWPAERQERFIARVVDALSDPRVTHEIRSIWLSYWSADRMLGQKIATKLNVKANM*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCCTATAAGGTTTGATTCTCACCTTTTGCGCCGTAGCAGCTAGCGTAGAGTAGCTTATTGATTCTTTGCGCATTGCGGTGCCGGATCAATCTAGAGCAGTTTCTTCGCAATCGT
GGTCTAGGCCTCCATTTCTTGATCTTCTTGCTCGATTTGTTCACGATTTGACAAAATTTCCTTGGATTTCTCCAGTATCGCCCTTCCAGCGCCTATAATTCGGCCCATTTCACCACGAAC
ACTGGCGCTCCTGTGTGGAACAACAATGCGTCGCTCACCGTGGGCTCTCGAG
GTACACAATTTCTTTCTATCCATAGCCCAAAATACTTACTTCATTGTATCTTTGTTTTTTTTTTTTTT
TTTCTTGCCAGGTCCTATCCTTCTCGAGGATTATCATCTGGTCGAGAAGCTGGCCCAGTTTGATCGTGAAAGAATTCCCGAGCGTGTCGTGCATGCACGAGGAGCGAGTGCCAAGGGATT
TTTCGAGGTGACCCACGACGTATCCCACCTCACTTGTGCCGATTTCCTGAGAGCTCCCGGAGTGCAAACTCCCGTTATCGTGCGGTTTTCTACTGTCATTCACGAGCGTGGCAGCCCAGA
AACTCTTCGAGATCCTCGAGGCTTTGCGGTCAAGTTCTACACTCGAGAG
GTTTGTAGTTTTTTTGTTTGGCTTTCTTTCGTTTTTCTCAAAGAATGTGGTGTTGTGGATGCAGGGAAACT
TTGATATGGTTGGAAACAATTTTCCCGTGTTCTTCGTCCGAGATGGAATGAAGTTCCCTGACATGGTCCATGCGCTGAAGCCCAACCCAAGGACTCATATCCAGGAGAATTGGAGGATCA
TGGACTTCTTCTCGCACCATCCCGAGAGTCTTCACATGTTCACGTTCCTGCTCGACGATATTGGCATCCCGCTCAACTATCGTCATATGGAGGGCTTTGGCGTCCACACTTTCACTCTCG
TGAACCGGGCTGGCAAGTGCTCCTACGTGAAGTTCCACTGGAAGCCAACTTGTGGTGTCAAGAGCTTGCTGGAAGAACAGGCAGTCATCGTTGGTGGATCGAACCACAGCCATGCAACGC
AGGATCTGCAAGACTCTATTGCAGCAGGGAACTATCCCGAGTGGAAGCTGTTTATCCAGACCATGGAAATCAAGAACGAGAACAACTACGACTTCGATCCTTTGGATGTTACCAAGACGT
GGCCCGAGGATCTCTTCCCGCTGCAGCCCGTGGGTCGGCTAGTTTTAAACAAGAACATCGACAACTTCTTTGCGGAGAACGAGCAGCTGGCTTTCTGCCCCGCTTTGGTGGTGCCTGGAG
TTTATTACACGGACGACAAGCTGCTTCAGACCCGAATTTTCTCGTACGCTGACACTCAGAGGCACAGGCTGGGGCCGAATTACTTGCTGCTTCCTGCGAACGCTCCCAAGTGTGCTCATC
ACAACAACCATCACGAGGGATTCATGAACTTCACCCACAGGGACGAAGAG
GTATGACAAGCTTTTGCTTATACGTTCTATATCCTGTGTTTGCAGGTGAACTATTTCCCTTCGCGCTTTG
ATCCTTGCCGTCACGCTGAGCGAGTGCCTATTCCTTCTCACCCTCTCGGTGGTCGACGAGAAAAG
GTTTGGCTATCTTCTCATTTTATGCTTTGGCAATAATGTTTTTCTCTTGTAGGTG
ATGATTGAAAAGGAAAATAACTTTGCTCAGCCAGGAGCAAGGTTCCGCTCCTGGCCTGCTGAGAG
GCAAGATCTCAAACCTCTCTCTCAGCTAGTCATGTTTTAACTGAATCTCTGCTCC
TCTTCCAGGCAAGAGCGTTTCATTGCGAGAGTTGTGGATGCTCTGTCCGACCCGCGCGTCACCCACGAAATCCGTAGCATCTGGCTCTCTTACTGGTCTCAGGTTAGACAAGAAAGAAAA
GACAGCATGTGATCAAACTCAACCATGAAACGTGTGCAGGCGGATCGTATGCTTGGTCAGAAGATTGCAACGAAACTCAACGTGAAAGCCAACATGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCCTATAAGTATCGCCCTTCCAGCGCCTATAATTCGGCCCATTTCACCACGAACACTGGCGCTCCTGTGTGGAACAACAATGCGTCGCTCACCGTGGGCTCTCGAGGTCCTATC
CTTCTCGAGGATTATCATCTGGTCGAGAAGCTGGCCCAGTTTGATCGTGAAAGAATTCCCGAGCGTGTCGTGCATGCACGAGGAGCGAGTGCCAAGGGATTTTTCGAGGTGACCCACGAC
GTATCCCACCTCACTTGTGCCGATTTCCTGAGAGCTCCCGGAGTGCAAACTCCCGTTATCGTGCGGTTTTCTACTGTCATTCACGAGCGTGGCAGCCCAGAAACTCTTCGAGATCCTCGA
GGCTTTGCGGTCAAGTTCTACACTCGAGAG
GGAAACTTTGATATGGTTGGAAACAATTTTCCCGTGTTCTTCGTCCGAGATGGAATGAAGTTCCCTGACATGGTCCATGCGCTGAAGCCC
AACCCAAGGACTCATATCCAGGAGAATTGGAGGATCATGGACTTCTTCTCGCACCATCCCGAGAGTCTTCACATGTTCACGTTCCTGCTCGACGATATTGGCATCCCGCTCAACTATCGT
CATATGGAGGGCTTTGGCGTCCACACTTTCACTCTCGTGAACCGGGCTGGCAAGTGCTCCTACGTGAAGTTCCACTGGAAGCCAACTTGTGGTGTCAAGAGCTTGCTGGAAGAACAGGCA
GTCATCGTTGGTGGATCGAACCACAGCCATGCAACGCAGGATCTGCAAGACTCTATTGCAGCAGGGAACTATCCCGAGTGGAAGCTGTTTATCCAGACCATGGAAATCAAGAACGAGAAC
AACTACGACTTCGATCCTTTGGATGTTACCAAGACGTGGCCCGAGGATCTCTTCCCGCTGCAGCCCGTGGGTCGGCTAGTTTTAAACAAGAACATCGACAACTTCTTTGCGGAGAACGAG
CAGCTGGCTTTCTGCCCCGCTTTGGTGGTGCCTGGAGTTTATTACACGGACGACAAGCTGCTTCAGACCCGAATTTTCTCGTACGCTGACACTCAGAGGCACAGGCTGGGGCCGAATTAC
TTGCTGCTTCCTGCGAACGCTCCCAAGTGTGCTCATCACAACAACCATCACGAGGGATTCATGAACTTCACCCACAGGGACGAAGAG
GTGAACTATTTCCCTTCGCGCTTTGATCCTTGC
CGTCACGCTGAGCGAGTGCCTATTCCTTCTCACCCTCTCGGTGGTCGACGAGAAAAG
GTGATGATTGAAAAGGAAAATAACTTTGCTCAGCCAGGAGCAAGGTTCCGCTCCTGGCCTGCT
GAGAG
GCAAGAGCGTTTCATTGCGAGAGTTGTGGATGCTCTGTCCGACCCGCGCGTCACCCACGAAATCCGTAGCATCTGGCTCTCTTACTGGTCTCAGGCGGATCGTATGCTTGGTCAG
AAGATTGCAACGAAACTCAACGTGAAAGCCAACATGTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCCT ATAAGTATCG CCCTTCCAGC GCCTATAATT CGGCCCATTT CACCACGAAC ACTGGCGCTC CTGTGTGGAA CAACAATGCG TCGCTCACCG TGGGCTCTCG AGGTCCTATC  CTTCTCGAGG ATTATCATCT GGTCGAGAAG CTGGCCCAGT TTGATCGTGA AAGAATTCCC GAGCGTGTCG TGCATGCACG AGGAGCGAGT GCCAAGGGAT TTTTCGAGGT GACCCACGAC  GTATCCCACC TCACTTGTGC CGATTTCCTG AGAGCTCCCG GAGTGCAAAC TCCCGTTATC GTGCGGTTTT CTACTGTCAT TCACGAGCGT GGCAGCCCAG AAACTCTTCG AGATCCTCGA  GGCTTTGCGG TCAAGTTCTA CACTCGAGAG GGAAACTTTG ATATGGTTGG AAACAATTTT CCCGTGTTCT TCGTCCGAGA TGGAATGAAG TTCCCTGACA TGGTCCATGC GCTGAAGCCC  AACCCAAGGA CTCATATCCA GGAGAATTGG AGGATCATGG ACTTCTTCTC GCACCATCCC GAGAGTCTTC ACATGTTCAC GTTCCTGCTC GACGATATTG GCATCCCGCT CAACTATCGT  CATATGGAGG GCTTTGGCGT CCACACTTTC ACTCTCGTGA ACCGGGCTGG CAAGTGCTCC TACGTGAAGT TCCACTGGAA GCCAACTTGT GGTGTCAAGA GCTTGCTGGA AGAACAGGCA  GTCATCGTTG GTGGATCGAA CCACAGCCAT GCAACGCAGG ATCTGCAAGA CTCTATTGCA GCAGGGAACT ATCCCGAGTG GAAGCTGTTT ATCCAGACCA TGGAAATCAA GAACGAGAAC  AACTACGACT TCGATCCTTT GGATGTTACC AAGACGTGGC CCGAGGATCT CTTCCCGCTG CAGCCCGTGG GTCGGCTAGT TTTAAACAAG AACATCGACA ACTTCTTTGC GGAGAACGAG  CAGCTGGCTT TCTGCCCCGC TTTGGTGGTG CCTGGAGTTT ATTACACGGA CGACAAGCTG CTTCAGACCC GAATTTTCTC GTACGCTGAC ACTCAGAGGC ACAGGCTGGG GCCGAATTAC  TTGCTGCTTC CTGCGAACGC TCCCAAGTGT GCTCATCACA ACAACCATCA CGAGGGATTC ATGAACTTCA CCCACAGGGA CGAAGAGGTG AACTATTTCC CTTCGCGCTT TGATCCTTGC  CGTCACGCTG AGCGAGTGCC TATTCCTTCT CACCCTCTCG GTGGTCGACG AGAAAAGGTG ATGATTGAAA AGGAAAATAA CTTTGCTCAG CCAGGAGCAA GGTTCCGCTC CTGGCCTGCT  GAGAGGCAAG AGCGTTTCAT TGCGAGAGTT GTGGATGCTC TGTCCGACCC GCGCGTCACC CACGAAATCC GTAGCATCTG GCTCTCTTAC TGGTCTCAGG CGGATCGTAT GCTTGGTCAG 
AAGATTGCAA CGAAACTCAA CGTGAAAGCC AACATGTAG 

Retrieve as FASTA