Entry information : SmKat03-1_34 (SmKat03a_34)
Entry ID 6216
Creation 2008-07-07 (Christophe Dunand)
Last sequence changes 2011-01-25 (Toky Ramarohetra (Scipio))
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmKat03-1_34 (SmKat03a_34)
Name (synonym) SmKat03-1_34 (SmKat03a_34)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type strobili (cone)
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmKat03-1_34
start..stop
S start..stop
SmKat03-2_26 1065 0 1..517 1..517
MpKat02 786 0 9..517 80..601
PpaKat05 772 0 14..517 8..513
PpaKat04 770 0 19..517 35..534
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 941796..941923 128 N° 2 941554..941697 144 N° 3 941175..941493 319 N° 4 940801..941118 318
N° 5 940535..940747 213 N° 6 940305..940462 158 N° 7 939962..940235 274  
complement(join(939962..940235,940305..940462,940535..940747,940801..941118,9411 75..941493,941554..941697,941796..941923))


exon

Literature and cross-references SmKat03-1_34 (SmKat03a_34)
Literature Richardson,P., Lucas,S., Rokhsar,D., Wang,M. and Lindquist,E.A.
DOE Joint Genome Institute Selaginella moellendorffii EST project.
unpublished (2008)
DNA ref. Phytozome 12:   scaffold_34 (941923..939962)
mRNA ref. JGI transcript:   106736 [Incorrect splicing]
EST ref. GenBank:   FE497496.1 [5' end]   FE511042.1 [3' end]
Protein sequence: SmKat03-1_34 (SmKat03a_34)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   517
PWM (Da):   %s   58407.06  
PI (pH):   %s   6.91
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDAESGSKASNGNSKSASVRVGSSGKPLHTTLAGAPVSDDNNSVTIGQSGHLLFEDVHLFEKQARLNRERVPERVVHAKGAGAHGYFEVTKDVSNLCKAKFLSEPGKRTPVFARFSSVAAERGFTDLARDVRGFAVKFYTEEGNWDMTGNNTPVFWVRDPLKFPDFVHSQKRNPKTNAKDPNAFWDFLSLVPESMHLLITFSPRGVPATYRNMNGYGSHTFKWVNKEGKAHWVKFHLVTEHGIKNLTHEEAVSLSGSKPDYATEDLLTSIEEGNFPAWKFCVQVMPLEDAPKYKWDPFDLTKVWLHKDYPLMEVGRLVLDRNVENYHAEVEQAAFSPGSFVPGIEASPDRILQSRLFAYDDAARYRIGTNFHDVPINKPIVKVQTYSRDGAMVVSDNGGSKPNYYPNSYDNLPRNDPTQPDVHPYEHEGGTVDRFPPRKWEEQDDYEQPRMLWKLMSEEDKEQTVSNIANHIRGAAEFIQERQMGLFRKCDGDLASRIEKKLAEKKKSPEPYTMIA

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns) and ESTs. Unigene compiles both allele.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACGCCGAGAGTGGATCCAAGGCCTCGAATGGCAACAGCAAGAGCGCTAGCGTGCGAGTTGGAAGCTCGGGCAAGCCTCTCCACACCACGCTCGCCGGAGCTCCAGTCTCGGACGAT
AACAACAG
GTACTGTGGTTCTTCCCAAAGCTTGGATTCGATCAAAAGCTTTGGTTTTTTTTTCTTGGATTCGATCGAAAGCTTTGTTTTTCTTTGTGTTCCTCTAGTGTAACTATAGGAC
AGAGTGGACACCTTTTGTTTGAAGACGTCCATTTGTTTGAGAAGCAAGCACGGCTCAACCGTGAGAGAGTTCCCGAGCGCGTCGTCCATGCCAAAGGTGCCGGAGCTCACGGATACTTCG
AAGTTACAAA
GTAAGTCTGCTACTCGGCTCGCTTGTTTCTTTTACGTTTCGGACTCCATGCCATTTGTAGGGACGTATCAAACTTGTGCAAGGCCAAGTTCTTGAGCGAGCCCGGAAAGA
GGACCCCCGTTTTCGCCAGGTTCTCGAGCGTGGCGGCCGAGCGTGGATTCACCGACCTTGCGCGAGATGTCCGAGGCTTCGCGGTTAAGTTTTACACCGAGGAAGGGAACTGGGACATGA
CCGGGAATAACACGCCAGTTTTCTGGGTCCGGGACCCTCTCAAGTTTCCCGACTTTGTCCACTCGCAAAAGAGGAACCCCAAGACCAACGCCAAAGATCCAAACGCGTTCTGGGATTTTC
TGAGCTTGGTTCCCGAGTCCATGCATCAG
GTAACTTAGAACTCTTTGCGTAACTTTGATCAACTTTGTCGATTCTCCTTGTGAAGCTTTTGATCACATTCTCGCCTCGAGGAGTGCCGGC
TACGTATAGAAACATGAACGGATACGGCTCGCATACTTTCAAGTGGGTCAACAAGGAGGGGAAAGCTCACTGGGTGAAGTTCCATCTCGTCACGGAGCACGGCATCAAAAACTTGACCCA
CGAAGAGGCCGTGAGTCTCTCGGGGTCTAAACCAGACTACGCGACCGAGGATCTCTTGACTAGCATAGAGGAAGGGAACTTCCCGGCCTGGAAGTTCTGCGTCCAAGTCATGCCGCTGGA
GGACGCTCCAAAGTATAAGTGGGATCCTTTCGACTTGACAAAG
GTATGTGACACAAGTTTTCTTCTTCTTCTGTTTTTCAAGGACGTGGATTTCAGGTGTGGTTGCACAAGGATTATCCC
CTCATGGAAGTTGGCAGGCTCGTTCTCGATAGAAATGTCGAAAACTATCACGCGGAAGTGGAGCAAGCGGCATTCTCTCCAGGAAGCTTTGTTCCTGGGATTGAGGCTTCCCCGGACCGT
ATACTCCAGTCCCGGCTCTTTGCTTACGACGACGCTGCTCGATACAGAATTGGGACAAACTTCCACGAC
GTAAGAATTTATAAACGTATGTCTTTTTCCAAAGATTCTAAATGTGATCTG
CTTGTGTCTACCACCATCCAGGTTCCGATCAACAAACCCATTGTGAAAGTCCAGACATATTCTCGAGATGGAGCGATGGTTGTCTCGGACAACGGCGGCAGCAAACCCAATTACTATCCG
AACTCGTACGACAACTTGCCTCGAAACGACCCGACTCAGCCGGATGTTCACCCGTACGA
GTAAGCAAAGCTTTTGTTTCCTATCTCCGGGAAGGAGCTTCTAACATTCCTGTTCCTTCTT
CTACGCAGGCATGAAGGTGGAACAGTTGACCGGTTCCCTCCAAGAAAATGGGAAGAACAGGACGACTACGAGCAGCCCCGTATGCTCTGGAAACTCATGTCCGAGGAAGACAAGGAGCAA
ACCGTGTCAAACATCGCAAACCACATCCGCGGAGCCGCCGAGTTCATCCAAGAGCGTCAAATGGGTCTCTTCCGGAAATGCGACGGGGATCTCGCGTCCAGGATCGAGAAGAAGCTCGCG
GAGAAGAAGAAGTCGCCGGAGCCGTATACCATGATCGCCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACGCCGAGAGTGGATCCAAGGCCTCGAATGGCAACAGCAAGAGCGCTAGCGTGCGAGTTGGAAGCTCGGGCAAGCCTCTCCACACCACGCTCGCCGGAGCTCCAGTCTCGGACGAT
AACAACAG
TGTAACTATAGGACAGAGTGGACACCTTTTGTTTGAAGACGTCCATTTGTTTGAGAAGCAAGCACGGCTCAACCGTGAGAGAGTTCCCGAGCGCGTCGTCCATGCCAAAGGT
GCCGGAGCTCACGGATACTTCGAAGTTACAAA
GGACGTATCAAACTTGTGCAAGGCCAAGTTCTTGAGCGAGCCCGGAAAGAGGACCCCCGTTTTCGCCAGGTTCTCGAGCGTGGCGGCC
GAGCGTGGATTCACCGACCTTGCGCGAGATGTCCGAGGCTTCGCGGTTAAGTTTTACACCGAGGAAGGGAACTGGGACATGACCGGGAATAACACGCCAGTTTTCTGGGTCCGGGACCCT
CTCAAGTTTCCCGACTTTGTCCACTCGCAAAAGAGGAACCCCAAGACCAACGCCAAAGATCCAAACGCGTTCTGGGATTTTCTGAGCTTGGTTCCCGAGTCCATGCATCAG
CTTTTGATC
ACATTCTCGCCTCGAGGAGTGCCGGCTACGTATAGAAACATGAACGGATACGGCTCGCATACTTTCAAGTGGGTCAACAAGGAGGGGAAAGCTCACTGGGTGAAGTTCCATCTCGTCACG
GAGCACGGCATCAAAAACTTGACCCACGAAGAGGCCGTGAGTCTCTCGGGGTCTAAACCAGACTACGCGACCGAGGATCTCTTGACTAGCATAGAGGAAGGGAACTTCCCGGCCTGGAAG
TTCTGCGTCCAAGTCATGCCGCTGGAGGACGCTCCAAAGTATAAGTGGGATCCTTTCGACTTGACAAAG
GTGTGGTTGCACAAGGATTATCCCCTCATGGAAGTTGGCAGGCTCGTTCTC
GATAGAAATGTCGAAAACTATCACGCGGAAGTGGAGCAAGCGGCATTCTCTCCAGGAAGCTTTGTTCCTGGGATTGAGGCTTCCCCGGACCGTATACTCCAGTCCCGGCTCTTTGCTTAC
GACGACGCTGCTCGATACAGAATTGGGACAAACTTCCACGAC
GTTCCGATCAACAAACCCATTGTGAAAGTCCAGACATATTCTCGAGATGGAGCGATGGTTGTCTCGGACAACGGCGGC
AGCAAACCCAATTACTATCCGAACTCGTACGACAACTTGCCTCGAAACGACCCGACTCAGCCGGATGTTCACCCGTACGA
GCATGAAGGTGGAACAGTTGACCGGTTCCCTCCAAGAAAA
TGGGAAGAACAGGACGACTACGAGCAGCCCCGTATGCTCTGGAAACTCATGTCCGAGGAAGACAAGGAGCAAACCGTGTCAAACATCGCAAACCACATCCGCGGAGCCGCCGAGTTCATC
CAAGAGCGTCAAATGGGTCTCTTCCGGAAATGCGACGGGGATCTCGCGTCCAGGATCGAGAAGAAGCTCGCGGAGAAGAAGAAGTCGCCGGAGCCGTATACCATGATCGCCTAG

Retrieve as FASTA