Entry information : PpaDiOx01
Entry ID 6271
Creation 2008-07-11 (Marcel Zamocky)
Last sequence changes 2008-07-11 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: PpaDiOx01
Name PpaDiOx01
Class Alpha-dioxygenase    [Orthogroup: DiOx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaDiOx01
start..stop
S start..stop
MpDiOx02 722 0 5..634 1..603
PabDiOx01 714 0 21..634 25..636
EcamDiOx01 711 0 7..634 5..629
MpDiOx01 708 0 7..635 2..609
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 122886..122984 99 N° 2 123697..123966 270 N° 3 124088..124237 150 N° 4 124342..124472 131
N° 5 124584..124797 214 N° 6 124933..125078 146 N° 7 125212..125442 231 N° 8 125549..125751 203
N° 9 125863..126106 244 N° 10 126218..126464 247  
join(122886..122984,123697..123966,124088..124237,124342..124472,124584..124797, 124933..125078,125212..125442,125549..125751,125863..126106,126218..126464)


exon

Literature and cross-references PpaDiOx01
Literature Rensing S., et al., The physcomitrella genome reveals evolutionary insights into the conquest of land by plants. Science 319:64-69(2008).
Protein ref. UniProtKB:   A9T3F4
DNA ref. Phytozome 12:   scaffold_159 (122886..126464)
EST ref. GenBank:   BJ942409.1 [Fragment]
Cluster/Prediction ref. UniGene:   Ppa.1843 [5' end]   Ppa.13350 [3' end]
Protein sequence: PpaDiOx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   644
PWM (Da):   %s   73003.37  
PI (pH):   %s   7.04
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGQVFGALTSWMVLPDLRPTYRQMSFVHETMFLVVHFSDRFWRWYNTPVVFGLLYLELRRTIQQNYNLIAVGNAKDRNLQVPTPSRMAVVNYIDQPGSSSHTTFDEEDYAGFFGRNMGPQKSELVNPHPSVVAAKLLSRTELKDYGKQFNMIAASWINFMIHDWVDHLEELSKEVEITAPPSVSAQCPLKNFMFYPTKEVPAGNNVTGHINTRTPWWDASVIYGSTKEAERNVRTFRDGKLKVRPDGWLMTDEDNLPVTGDIRNLWVGVAMLQSLFIAEHNMVCDTIKAHPDFNDEELFQHARVVTAAVLAKIHTIDWTPQLLKNNVLLAAMRANWYGLLGKRFKDTFGTTPISLLSGLVGMKKPVDHGVPYSLTEEFTAVYRLHPLLPEKIDIKNITATASSSLHTPPTVDEIAVPELLGNKGNDKALKLGLKTLLTSLGHQSAGALQLFNYPQWMREVTSQNRDGTDRPDKVDMASLIYRDRERSVARYNQFRRNLVMPTIGKWEDLTEDKQTLAILRELYGNNVESLDLLVGLLVEKKPPGFAISETAFVIFVLMASRRLEADPLFTSHFNEKVYTEEGLKWVNTTEGLKDVLRRHHPELVGDWMTASSAFSLWNQTPEKPSWIPLYLRWGANSPAASS

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns) and 59 ESTs (29+1+29). Ecotype="Gransden 2004".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGACAAGTTTTCGGAGCTCTGACTTCGTGGATGGTGCTCCCAGATCTTCGACCCACGTACAGACAGATGAGCTTCGTTCACGAAACCATGTTTCTCGTGAGCACTCACCACCTTCGC
CGATGCCCCTCGTATGTGATTGGATTGTTCACACCAAGGAATGTGTCGTTATGTTCGAAATGCCCATGTTTTGAACATCATGCTTCACGTACCATGTCTTTTAGGTATTGAGGACCGGTC
GATTGGCAGATCATAATAAGTTTCGGGATTCAAGGTTTCGAGACCGGCTCTGTAAATGTTCGACAACCAAATACTTGTATACGACGTTGAACACACTTCAAGTGTAGTAATTCTTTCAAA
TCACATCCATTGCAATTTAAGATACTCCACCAGGTAGATGCCAACAAGGAAGTATACTTGCTGAATATCCGGAACCTCATCGAATTGTTGCTCTTTTTCAAGAACAGAACCGCAGAAAAG
TGACATAGAAGTTTGAAAAGGTTCTGCTCATTTTAACGGTGATTATGTCGACTGAATGGGTGTTGAACTTTCATGGGGTAGTTTCCTTGGGGCTTGACTGTGTAGGGGCTGTCATCGATG
TTCTCGCGCTTCATTATGCATCTTCGTTCAGGATGCCTCACTTGGATAAATTCGCTACTAACAAGCTCGTGATAAATCTGCATCAAACCACAGCATGCGTTCCACATGGCCTTTGCAGCC
AAGCGATTGTAGATTACTAGTATTGTCTGCAGCCAATTCTCTGACACCAGAATCTCTGACTAAAAAACTGAACCATCTCGTCCCCCAACAGGTAGTGCACTTCTCCGACCGCTTCTGGAG
ATGGTACAACACCCCTGTTGTGTTCGGTCTGTTGTACCTGGAACTTCGACGAACTATTCAGCAGAACTACAACCTCATAGCTGTCGGAAATGCGAAGGATCGCAATCTCCAGGTTCCAAC
TCCAAGTCGAATGGCGGTTGTCAATTATATTGATCAACCAGGAAGCAGTAGCCACACCACATTTGATGAGGAAGATTATGCTGGCTTCTTTGGGCGCAACATGGGGCCTCAAAAGAGCGA
G
GTGCACCTCTCTGACACTTATAATTGATCAATATGGTATAGCTTGCTAGGGGCGTAATAGCATTCGGTAAGTACTAGAGTTAGCAAACTGCAAACTGATCTCTGTTCGTCGTTGTGTGC
AGCTGGTCAACCCCCATCCATCTGTTGTGGCCGCGAAGTTGCTATCTAGGACGGAATTGAAAGATTACGGAAAACAATTTAACATGATAGCTGCTTCATGGATCAACTTCATGATTCACG
ACTGGGTTGATCACCTAGAGGAATTGAGCAAG
GTGCAATTCATCATTAGTAACCATGGCTAGAAACTCATGTGCTCACTGATCAAACTTGAAACTCGAACTGAACAGAATCTAACAGTGC
CAGTTCTGGTGCTCAGGAAGTCGAGATTACGGCTCCACCCTCTGTTTCGGCGCAGTGTCCTTTGAAGAATTTCATGTTTTACCCTACGAAGGAGGTTCCTGCAGGCAACAACGTGACCGG
TCACATCAACACTCGAACACCTTGGTG
GTACGGTTCCTCTGGGAGGAAGGCTTAATTTCCAAATAAAAATGCCACTAAGCTCTGCTTTCCGAAAGACAAGCTAATTGAGTAGAATTATGT
GTATGTTGTGACGAGCAGGGACGCAAGTGTAATCTACGGAAGCACTAAAGAAGCCGAGCGTAATGTTCGAACATTCCGAGACGGCAAGCTCAAGGTCCGACCAGATGGTTGGCTAATGAC
CGACGAGGACAACCTCCCGGTCACTGGCGACATCCGCAACCTCTGGGTCGGAGTGGCGATGCTCCAATCTCTGTTTATTGCAGAGCACAACATGGTCTGCGATACAATCAAG
GTCAGTCA
CATATGAAGCGCAATTTCTCCTCCACACCTTGTTAGCCACGACTAGTTGAGGTTTAATGCTGCAGACTTGCTGCGCGGTGCTGGGACTTACCAACGAATTCCTCCAAACGTCTCCCGCTT
TGAACAGAAAGCGCATCCAGACTTCAATGACGAGGAGCTCTTCCAGCACGCCAGGGTTGTGACTGCTGCGGTACTCGCGAAGATCCACACTATTGACTGGACGCCGCAGCTGCTGAAGAA
CAATGTCTTGCTCGCAGCAATGCGTGCCAACTG
GTAAGCTAATGTGCCCTCAATCATCTTTAGAAACGGAGATCACAACGTGCACATGAACATTCGAATCTTATGAATGTTGTCTCACGT
CCATCATGTTTTACTCACTTCCTGCACGAGGCTCTGTCTGTCATAGGTATGGATTGTTGGGAAAGAGATTCAAGGATACGTTCGGCACTACTCCTATCTCGCTCTTGAGTGGGTTGGTCG
GCATGAAGAAACCAGTGGATCATGGTGTGCCCTACTCACTCACAGAGGAGTTTACAGCAGTGTACCGGTTACATCCTTTGCTGCCTGAGAAGATTGACATTAAGAACATTACGGCAACTG
CGAGCAGTAGCCTACACACACCACCAACCGTAGACGA
GTAAGTCCGTTCCTTCGTGGCCAGTTTATCGAACATTTAACCCATTGACAAGAAGCTCCCAAACAAGAGAAAGGAGTTCAATG
ATTTGACATTTAAACATTGGCAGGATTGCTGTGCCTGAGCTGCTTGGAAACAAGGGGAACGACAAGGCACTGAAACTTGGGTTGAAGACGCTTCTCACATCTCTAGGACATCAATCCGCA
GGAGCTTTACAATTGTTCAATTACCCTCAATGGATGCGGGAAGTGACCTCTCAGAACAGGGACGGTACTGACCGGCCGGACAAGGTGGACATGGCCAGCCTTGAGA
GTAAGTGTATCATT
GTAAGAATATCCAGCATAATTCAGTCTGCGGTGATATAATTGTGCATAAGAATATTGCTATCAAGTGTTAAGTGCATTCGCAACGTTGCTCTTGCAGTTTATCGAGACCGGGAGCGCTCT
GTGGCTCGCTACAACCAGTTCCGAAGGAACTTGGTGATGCCCACCATTGGGAAGTGGGAAGATTTGACAGAAGACAAGCAAACGCTAGCAATTCTTCGCGAGCTTTACGGCAACAATGTG
GAGAGCCTTGATTTGCTAGTAGGGCTGCTGGTGGAGAAGAAACCCCCAGGGTTTGCCATCAGCGAGACTGCCTTCGTCATTTTTGTTCTCATGGCCTCCAG
GTGACGGTGTACACGACGC
TCAAATTTTATTTCATGAGTCCATAGAAGTGATGCTGACCCATATTAACCTACTGGTTCCAATCGCTGGCCAATTTGTGTTTCTCTGTGCAGGCGTTTGGAAGCGGATCCGCTTTTTACT
TCACACTTCAACGAAAAAGTGTATACCGAGGAGGGATTGAAGTGGGTGAACACCACGGAGGGCCTCAAGGATGTGCTGCGTCGCCACCATCCCGAGCTGGTGGGAGACTGGATGACGGCA
TCTTCGGCATTCTCGCTATGGAATCAGACACCAGAGAAGCCGAGTTGGATCCCTTTGTACCTCCGCTGGGGCGCGAACTCCCCTGCAGCGAGCTCCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGACAAGTTTTCGGAGCTCTGACTTCGTGGATGGTGCTCCCAGATCTTCGACCCACGTACAGACAGATGAGCTTCGTTCACGAAACCATGTTTCTCGTAGTGCACTTCTCCGACCGC
TTCTGGAGATGGTACAACACCCCTGTTGTGTTCGGTCTGTTGTACCTGGAACTTCGACGAACTATTCAGCAGAACTACAACCTCATAGCTGTCGGAAATGCGAAGGATCGCAATCTCCAG
GTTCCAACTCCAAGTCGAATGGCGGTTGTCAATTATATTGATCAACCAGGAAGCAGTAGCCACACCACATTTGATGAGGAAGATTATGCTGGCTTCTTTGGGCGCAACATGGGGCCTCAA
AAGAGCGAG
CTGGTCAACCCCCATCCATCTGTTGTGGCCGCGAAGTTGCTATCTAGGACGGAATTGAAAGATTACGGAAAACAATTTAACATGATAGCTGCTTCATGGATCAACTTCATG
ATTCACGACTGGGTTGATCACCTAGAGGAATTGAGCAAG
GAAGTCGAGATTACGGCTCCACCCTCTGTTTCGGCGCAGTGTCCTTTGAAGAATTTCATGTTTTACCCTACGAAGGAGGTT
CCTGCAGGCAACAACGTGACCGGTCACATCAACACTCGAACACCTTGGTG
GGACGCAAGTGTAATCTACGGAAGCACTAAAGAAGCCGAGCGTAATGTTCGAACATTCCGAGACGGCAAG
CTCAAGGTCCGACCAGATGGTTGGCTAATGACCGACGAGGACAACCTCCCGGTCACTGGCGACATCCGCAACCTCTGGGTCGGAGTGGCGATGCTCCAATCTCTGTTTATTGCAGAGCAC
AACATGGTCTGCGATACAATCAAG
AAAGCGCATCCAGACTTCAATGACGAGGAGCTCTTCCAGCACGCCAGGGTTGTGACTGCTGCGGTACTCGCGAAGATCCACACTATTGACTGGACG
CCGCAGCTGCTGAAGAACAATGTCTTGCTCGCAGCAATGCGTGCCAACTG
GTATGGATTGTTGGGAAAGAGATTCAAGGATACGTTCGGCACTACTCCTATCTCGCTCTTGAGTGGGTTG
GTCGGCATGAAGAAACCAGTGGATCATGGTGTGCCCTACTCACTCACAGAGGAGTTTACAGCAGTGTACCGGTTACATCCTTTGCTGCCTGAGAAGATTGACATTAAGAACATTACGGCA
ACTGCGAGCAGTAGCCTACACACACCACCAACCGTAGACGA
GATTGCTGTGCCTGAGCTGCTTGGAAACAAGGGGAACGACAAGGCACTGAAACTTGGGTTGAAGACGCTTCTCACATCT
CTAGGACATCAATCCGCAGGAGCTTTACAATTGTTCAATTACCCTCAATGGATGCGGGAAGTGACCTCTCAGAACAGGGACGGTACTGACCGGCCGGACAAGGTGGACATGGCCAGCCTT
GAGA
TTTATCGAGACCGGGAGCGCTCTGTGGCTCGCTACAACCAGTTCCGAAGGAACTTGGTGATGCCCACCATTGGGAAGTGGGAAGATTTGACAGAAGACAAGCAAACGCTAGCAATT
CTTCGCGAGCTTTACGGCAACAATGTGGAGAGCCTTGATTTGCTAGTAGGGCTGCTGGTGGAGAAGAAACCCCCAGGGTTTGCCATCAGCGAGACTGCCTTCGTCATTTTTGTTCTCATG
GCCTCCAG
GCGTTTGGAAGCGGATCCGCTTTTTACTTCACACTTCAACGAAAAAGTGTATACCGAGGAGGGATTGAAGTGGGTGAACACCACGGAGGGCCTCAAGGATGTGCTGCGTCGC
CACCATCCCGAGCTGGTGGGAGACTGGATGACGGCATCTTCGGCATTCTCGCTATGGAATCAGACACCAGAGAAGCCGAGTTGGATCCCTTTGTACCTCCGCTGGGGCGCGAACTCCCCT
GCAGCGAGCTCCTGA

Retrieve as FASTA