Entry information : BfuKat01
Entry ID 6273
Creation 2008-07-11 (Marcel Zamocky)
Last sequence changes 2008-07-11 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: BfuKat01
Name BfuKat01
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Leotiomycetes Sclerotiniaceae Botryotinia
Organism Botryotinia fuckeliana (Botrytis cinerea Sclerotinia fuckeliana)    [TaxId: 40559 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BfuKat01
start..stop
S start..stop
SsclKat01 1426 0 1..737 1..738
CheKat02_C5 1068 0 41..737 41..740
CheKat02_C4 1068 0 41..737 41..740
PnoKat02 1060 0 1..737 1..743
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 555430..555756 327 N° 2 555814..556042 229 N° 3 556093..557750 1658  
join(555430..555756,555814..556042,556093..557750)


exon

Literature and cross-references BfuKat01
Literature Birren B.W., Galagan J.E., Lander E.S., Devon K., Nusbaum C., Cuomo C., Jaffe D.B., Butler J., Alvarez P., Gnerre S., Grabherr M., Kleber M., Mauceli E.W., Brockman W., Rounsley S., Young S.K., LaButti K., Pushparaj V., DeCaprio D., Crawford M., Koehrsen M., Engels R., Montgomery P., Pearson M., Howarth C., Alvarado L., Kodira C.D., Zeng Q., Yandava C., O'Leary S., Amedeo P., Briggs S., Baker S., Goff S., Hohn T., Hutchison D., Lam S., Martin C., Miguel T., Rose M., Turgeon B.G., Wu G., Yoder O., Zheng L.;
"Annotation of the Botryotinia fuckeliana B05.10 genome.";
(unpublished since 2005)
Protein ref. UniProtKB:   A6RPN4
DNA ref. JGI genome:   Supercontig_1.7 (555430..557750)
Protein sequence: BfuKat01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   737
PWM (Da):   %s   81888.66  
PI (pH):   %s   6.31
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQSVIGATVQKAGAAVSSAMSDKKTADMLPEMREPNTKEPLTSDFGVKHGNHDNWLSASSNDRQGPLLLEDNFGREKIMKFDHERIPERVVHARGAGAFGTFKLYESADDVTSAGVLTDTSRTTPVFIRFSTVLGSRGSADTVRDVRGFAVKFYTEEGNWDVVGNDIPVFFIQDAIKFPDVIHAGKPEPDNEIPQAQSAHNNFWDFQFLHTEATHMFMWAMSDRGIPRSYRMMQGFGVNTYTLINAQGKRSFVKFHFTPTLGVHSLVWDEALKIAGQDPDFHRKDLWTAIESGCYPKWKFGIQVCDESRQDEFDFDILDATKVWPEDILPVRYIGELELNKNVDEYFTQTEQVAFCTAHLVPGIGFSDDPLLQGRNFSYFDTQLSRLGVNWQELPVNRPVCPVMNNHRDGQMRHRITKGKINYWPNRESVVPPSKQSEGAYYEYPEKVVAMKQRLNSTKFKEHFSQAQLFWNSMSDVEKSHIINALGFELDHCDDPVVYERMVERLTDIDLGLAQAVAEKAGAPTPTKAGRPNHGNKAKGLSQFDFTPEALGLPATIASRMVAIIIADGFNFVEYEAVKGALTAAGALPFTIGPKRQPIKSSSGKSVSADHHFEGMRSTMFDSIYIPGGEHVSALLKQGRVIHWIREAFGHCKAIGATGEGVKLVQVACAVDGMAFSTSSEVVDSYGVVTAQGVGKTEEGLNMVKGAKNFLDAYTYNISQHRNFQRELDGLTSMVAF

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns). No EST. Strain="B05.10".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAATCAGTTATTGGAGCCACAGTACAGAAAGCGGGAGCTGCAGTATCTTCCGCCATGTCCGACAAGAAGACGGCAGATATGCTGCCTGAGATGAGAGAGCCAAATACAAAAGAACCT
CTTACCAGTGACTTTGGTGTCAAACATGGTAATCATGACAATTGGCTATCTGCTTCATCCAACGATCGCCAAGGTCCTTTATTGTTAGAAGATAACTTTGGTAGAGAAAAGATTATGAAA
TTCGATCATGAGCGTATACCTGAAAGAGTTGTTCACGCACGTGGAGCTGGAGCTTTTGGTACCTTCAAACTCTACGAGAGCGCCGAT
GTAAGTATCTCATTCCTTCACCTGACGCCAAGC
TATGGAAGCTAATCTCAAGTATAGGATGTTACAAGCGCTGGGGTTCTTACAGATACTTCTCGCACCACGCCAGTTTTCATCCGTTTTTCGACTGTTTTAGGTTCTCGTGGAAGTGCTGAT
ACTGTCAGAGATGTACGAGGTTTTGCCGTGAAGTTCTATACCGAAGAGGGTAACTGGGATGTTGTTGGAAATGACATTCCTGTCTTCTTCATTCAGGACGCTATCAAGTTTCCCGATGTC
ATCCATGCCGGAA
GTGAGTGCTCTCCCCTCAAGCATACATTCATGGTTACTAACTTTGCATAGAGCCTGAGCCGGATAATGAGATCCCTCAAGCACAGTCTGCACACAATAACTTCTGGG
ACTTCCAATTCCTACACACAGAGGCAACACATATGTTCATGTGGGCCATGTCAGATCGAGGCATTCCAAGATCCTACCGTATGATGCAAGGTTTCGGAGTGAACACATACACTTTGATAA
ACGCCCAAGGCAAACGATCATTCGTGAAATTTCATTTCACTCCAACTCTAGGTGTCCATTCACTCGTTTGGGATGAAGCATTAAAGATCGCAGGCCAAGACCCAGATTTCCATCGCAAAG
ATCTTTGGACCGCCATTGAAAGTGGATGTTATCCCAAATGGAAGTTTGGTATTCAAGTCTGCGACGAAAGTCGTCAAGACGAATTTGACTTCGACATTTTAGACGCGACTAAGGTTTGGC
CTGAAGATATTCTCCCCGTCCGATATATCGGTGAACTGGAGCTCAACAAGAATGTCGATGAATATTTCACACAAACTGAGCAAGTTGCTTTTTGCACTGCTCATCTTGTTCCTGGTATCG
GTTTTAGTGACGATCCACTACTCCAAGGCCGCAACTTCTCTTACTTCGATACTCAACTCTCAAGACTTGGTGTTAATTGGCAAGAGCTGCCTGTCAATCGACCAGTATGCCCTGTGATGA
ACAACCATCGCGATGGTCAAATGCGACACCGAATCACAAAAGGTAAAATAAACTACTGGCCCAACCGAGAAAGTGTTGTTCCTCCATCCAAGCAATCAGAGGGTGCCTATTACGAATATC
CCGAGAAGGTCGTAGCCATGAAACAACGGCTCAACTCTACTAAATTCAAGGAGCATTTCTCCCAAGCTCAATTGTTCTGGAACTCAATGTCTGATGTAGAAAAATCTCACATTATCAATG
CTCTAGGGTTTGAGCTTGATCATTGTGACGATCCCGTTGTATATGAGCGTATGGTTGAGCGTCTAACTGATATCGATCTCGGACTTGCACAAGCTGTAGCTGAGAAAGCCGGTGCCCCTA
CACCCACTAAAGCCGGACGCCCAAATCATGGCAACAAAGCCAAGGGTCTATCACAATTTGATTTCACTCCCGAAGCTCTAGGCTTACCAGCTACCATTGCTTCTCGTATGGTCGCAATCA
TCATCGCAGATGGGTTTAATTTCGTCGAATATGAAGCTGTAAAGGGGGCTTTGACCGCAGCCGGTGCTCTTCCATTCACCATCGGCCCCAAGAGACAACCAATAAAGAGTTCCAGTGGTA
AGAGTGTAAGTGCAGATCATCATTTCGAAGGTATGAGAAGTACAATGTTCGATTCGATCTATATTCCTGGTGGCGAACATGTCTCTGCACTACTTAAGCAAGGACGAGTAATTCACTGGA
TTCGCGAGGCTTTCGGTCATTGTAAAGCTATCGGAGCTACCGGCGAGGGAGTTAAGCTCGTACAAGTTGCATGTGCAGTTGATGGCATGGCTTTCAGTACCTCTAGTGAAGTAGTTGATT
CGTATGGTGTTGTGACTGCGCAAGGTGTAGGCAAAACCGAGGAAGGGTTGAATATGGTGAAGGGAGCGAAGAATTTCTTGGATGCGTATACGTATAATATCTCGCAACATAGGAACTTTC
AGAGGGAATTGGATGGATTGACTAGCATGGTTGCTTTTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAATCAGTTATTGGAGCCACAGTACAGAAAGCGGGAGCTGCAGTATCTTCCGCCATGTCCGACAAGAAGACGGCAGATATGCTGCCTGAGATGAGAGAGCCAAATACAAAAGAACCT
CTTACCAGTGACTTTGGTGTCAAACATGGTAATCATGACAATTGGCTATCTGCTTCATCCAACGATCGCCAAGGTCCTTTATTGTTAGAAGATAACTTTGGTAGAGAAAAGATTATGAAA
TTCGATCATGAGCGTATACCTGAAAGAGTTGTTCACGCACGTGGAGCTGGAGCTTTTGGTACCTTCAAACTCTACGAGAGCGCCGAT
GATGTTACAAGCGCTGGGGTTCTTACAGATACT
TCTCGCACCACGCCAGTTTTCATCCGTTTTTCGACTGTTTTAGGTTCTCGTGGAAGTGCTGATACTGTCAGAGATGTACGAGGTTTTGCCGTGAAGTTCTATACCGAAGAGGGTAACTGG
GATGTTGTTGGAAATGACATTCCTGTCTTCTTCATTCAGGACGCTATCAAGTTTCCCGATGTCATCCATGCCGGAA
AGCCTGAGCCGGATAATGAGATCCCTCAAGCACAGTCTGCACAC
AATAACTTCTGGGACTTCCAATTCCTACACACAGAGGCAACACATATGTTCATGTGGGCCATGTCAGATCGAGGCATTCCAAGATCCTACCGTATGATGCAAGGTTTCGGAGTGAACACA
TACACTTTGATAAACGCCCAAGGCAAACGATCATTCGTGAAATTTCATTTCACTCCAACTCTAGGTGTCCATTCACTCGTTTGGGATGAAGCATTAAAGATCGCAGGCCAAGACCCAGAT
TTCCATCGCAAAGATCTTTGGACCGCCATTGAAAGTGGATGTTATCCCAAATGGAAGTTTGGTATTCAAGTCTGCGACGAAAGTCGTCAAGACGAATTTGACTTCGACATTTTAGACGCG
ACTAAGGTTTGGCCTGAAGATATTCTCCCCGTCCGATATATCGGTGAACTGGAGCTCAACAAGAATGTCGATGAATATTTCACACAAACTGAGCAAGTTGCTTTTTGCACTGCTCATCTT
GTTCCTGGTATCGGTTTTAGTGACGATCCACTACTCCAAGGCCGCAACTTCTCTTACTTCGATACTCAACTCTCAAGACTTGGTGTTAATTGGCAAGAGCTGCCTGTCAATCGACCAGTA
TGCCCTGTGATGAACAACCATCGCGATGGTCAAATGCGACACCGAATCACAAAAGGTAAAATAAACTACTGGCCCAACCGAGAAAGTGTTGTTCCTCCATCCAAGCAATCAGAGGGTGCC
TATTACGAATATCCCGAGAAGGTCGTAGCCATGAAACAACGGCTCAACTCTACTAAATTCAAGGAGCATTTCTCCCAAGCTCAATTGTTCTGGAACTCAATGTCTGATGTAGAAAAATCT
CACATTATCAATGCTCTAGGGTTTGAGCTTGATCATTGTGACGATCCCGTTGTATATGAGCGTATGGTTGAGCGTCTAACTGATATCGATCTCGGACTTGCACAAGCTGTAGCTGAGAAA
GCCGGTGCCCCTACACCCACTAAAGCCGGACGCCCAAATCATGGCAACAAAGCCAAGGGTCTATCACAATTTGATTTCACTCCCGAAGCTCTAGGCTTACCAGCTACCATTGCTTCTCGT
ATGGTCGCAATCATCATCGCAGATGGGTTTAATTTCGTCGAATATGAAGCTGTAAAGGGGGCTTTGACCGCAGCCGGTGCTCTTCCATTCACCATCGGCCCCAAGAGACAACCAATAAAG
AGTTCCAGTGGTAAGAGTGTAAGTGCAGATCATCATTTCGAAGGTATGAGAAGTACAATGTTCGATTCGATCTATATTCCTGGTGGCGAACATGTCTCTGCACTACTTAAGCAAGGACGA
GTAATTCACTGGATTCGCGAGGCTTTCGGTCATTGTAAAGCTATCGGAGCTACCGGCGAGGGAGTTAAGCTCGTACAAGTTGCATGTGCAGTTGATGGCATGGCTTTCAGTACCTCTAGT
GAAGTAGTTGATTCGTATGGTGTTGTGACTGCGCAAGGTGTAGGCAAAACCGAGGAAGGGTTGAATATGGTGAAGGGAGCGAAGAATTTCTTGGATGCGTATACGTATAATATCTCGCAA
CATAGGAACTTTCAGAGGGAATTGGATGGATTGACTAGCATGGTTGCTTTTTAG

Retrieve as FASTA