Entry information : SsclKat01
Entry ID 6274
Creation 2008-07-11 (Marcel Zamocky)
Last sequence changes 2008-07-11 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-30 (Christophe Dunand)
Peroxidase information: SsclKat01
Name SsclKat01
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Leotiomycetes Sclerotiniaceae Sclerotinia
Organism Sclerotinia sclerotiorum    [TaxId: 5180 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SsclKat01
start..stop
S start..stop
BfuKat01 1426 0 1..738 1..737
CheKat02_C5 1062 0 4..738 5..740
CheKat02_C4 1062 0 4..738 5..740
PnoKat02 1061 0 23..738 24..743
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1776395..1776724 330 N° 2 1776109..1776337 229 N° 3 1774401..1776058 1658  
complement(join(1774401..1776058,1776109..1776337,1776395..1776724))


exon

Literature and cross-references SsclKat01
Literature Birren B.W., et al. Annotation of the Sclerotinia sclerotiorum 1980 genome. (unpublished since 2005)
Protein ref. UniProtKB:   A7EBU8
DNA ref. JGI genome:   Supercontig_2.3 (1776724..1774401)
Protein sequence: SsclKat01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   738
PWM (Da):   %s   82262.92  
PI (pH):   %s   6.38
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQSVVGVTMQKAGEAVASAMSSNKKVADMQPEIREPSKNECLTSDFGVKSGNHDKWLSASDGDRQGPLLLEDNFGREKIMKFDHERIPERVVHARGAGAFGNFKLYESANDVTSAGVLTDTSRTTPVFVRFSTVLGSRGSADTVRDVRGFAVKFYTDEGNWDIVGNDIPVFFIQDAFKFPDIIHAGKPEPDNEIPQAQSAHNNFWDFQFLHTEATHMFMWAMSDRGIPRSYRMMQGFGVNTYTLINAEGKRSFVKFHFTPTLGVHSLVWDEALKIAGQDPDFHRKDLWTAIESGSYPKWKFGIQVCEESRQDEFDFDILDATKVWPEDIIPVRYIGELELNKNVDEFFSQTEQAAFCTAHLVPGIGFSDDPLLQGRNFSYFDTQLSRLGVNWQELPINRPVCPVMNNHRDGQMRHRITKGKINYWPNRDTVIPPAKQSEGAYYEYPQKIAAMKQRLSSSKFKEHYNQAQLFWNSVSEVEKSHIINALSFELDHCDDPVVYERMVERLTDIDLYLAQAVAEKAGAPTPTKAGRPNHGKKTKGLSQFDFTPEALGLPATIKSRMVAIIIADGFNFLEYEAVKGALTAAGALPFTIGPKRQPINSSSVKSVSADHHFEGMRSTLFDAIYIPGGEHVSTLLKQGRVIHWIREAFGHCKAIGATGEGVKLVRAACEVEGMTFSTSGEVVDSHGVVTAEGVGKSEEGLNMVKGAKNFLDAFTYNISQHRNFQREMDGLTSMVAY

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns). Strain="ATCC18683/1980/Ss-1".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGTCAGTTGTTGGTGTTACGATGCAAAAAGCTGGAGAAGCGGTAGCTTCAGCTATGTCGTCTAACAAGAAGGTTGCAGATATGCAGCCAGAAATCAGAGAACCCAGTAAAAACGAG
TGTCTTACCAGTGACTTTGGTGTTAAATCTGGTAATCATGATAAATGGCTATCTGCTTCGGATGGTGATCGCCAAGGTCCGTTATTGCTAGAGGATAACTTTGGAAGGGAGAAGATTATG
AAGTTCGATCATGAACGCATACCAGAACGAGTTGTCCATGCACGTGGTGCTGGAGCTTTTGGTAACTTCAAACTTTACGAGAGTGCTAAT
GTAGGTATCTTGATCTTGAAAATCATTCCT
AAAAATCGGGGCTGACATGAAGTATAGGATGTTACAAGTGCCGGGGTTCTTACAGATACCTCTCGCACGACCCCAGTTTTCGTCCGCTTTTCGACAGTATTAGGTTCTCGTGGAAGTGCT
GATACAGTCAGAGATGTGCGAGGTTTTGCTGTCAAATTTTATACTGACGAGGGTAATTGGGATATTGTTGGAAACGACATTCCGGTTTTCTTCATTCAAGATGCTTTTAAATTTCCCGAT
ATCATTCATGCCGGAA
GTAAGTACTTCTTTCCCAAACATACATCCATGGTTACTGACTTTTCACAGAGCCGGAACCTGATAATGAAATCCCTCAAGCCCAATCGGCACATAATAACTTTT
GGGATTTCCAATTCTTACACACCGAAGCTACTCACATGTTTATGTGGGCCATGTCAGATCGAGGAATTCCAAGGTCTTATAGGATGATGCAAGGGTTCGGCGTCAATACATATACTTTAA
TAAATGCCGAAGGCAAACGATCATTCGTAAAATTCCACTTCACCCCAACTCTAGGGGTTCATTCTCTAGTTTGGGATGAGGCATTAAAGATCGCTGGTCAAGATCCGGATTTTCACCGCA
AAGACCTCTGGACAGCTATTGAAAGTGGATCATACCCCAAATGGAAGTTCGGAATTCAAGTTTGCGAGGAAAGTCGTCAAGATGAATTTGACTTTGACATCTTGGACGCGACTAAAGTTT
GGCCTGAAGATATTATCCCCGTCAGATACATTGGAGAACTGGAGCTCAACAAGAATGTTGATGAGTTTTTCTCACAAACAGAGCAAGCTGCTTTTTGCACCGCACATCTTGTGCCTGGCA
TTGGCTTTTCAGATGATCCTCTTCTTCAAGGCCGTAACTTCTCTTACTTTGATACCCAACTTTCACGCTTAGGTGTAAATTGGCAAGAGCTCCCTATAAACCGACCAGTATGCCCTGTTA
TGAACAACCACCGAGACGGTCAAATGCGACACCGAATCACCAAAGGCAAGATTAATTACTGGCCGAATCGAGATACTGTCATTCCCCCAGCAAAGCAATCAGAGGGCGCCTACTACGAAT
ACCCTCAGAAGATTGCAGCCATGAAACAACGTCTCAGCTCCTCAAAATTCAAGGAACACTACAACCAAGCTCAATTATTCTGGAACTCAGTTTCTGAGGTTGAAAAGTCTCACATTATCA
ATGCTCTAAGCTTCGAGCTTGATCACTGCGATGATCCTGTCGTATATGAACGTATGGTTGAACGACTAACAGATATTGATCTCTACCTAGCACAAGCCGTAGCTGAGAAAGCTGGTGCCC
CTACCCCTACTAAAGCGGGACGTCCCAATCACGGTAAAAAGACAAAAGGCCTTTCACAATTTGATTTTACTCCCGAAGCTCTAGGCTTACCAGCTACGATTAAATCTCGTATGGTTGCAA
TTATTATTGCCGATGGCTTCAATTTCCTCGAATACGAAGCCGTAAAGGGAGCACTGACCGCAGCCGGCGCTCTTCCATTTACCATCGGTCCCAAGAGACAACCAATCAACAGTTCTAGCG
TCAAGAGCGTAAGTGCAGATCATCACTTCGAAGGTATGAGAAGTACATTGTTCGACGCTATCTACATTCCTGGCGGCGAACACGTTTCTACTTTACTCAAACAAGGACGAGTAATCCACT
GGATCCGCGAAGCGTTCGGTCATTGTAAGGCTATTGGAGCCACAGGTGAAGGTGTAAAACTCGTACGAGCCGCATGTGAAGTTGAAGGTATGACATTTAGTACTTCTGGCGAAGTGGTGG
ATTCGCATGGTGTTGTGACGGCCGAGGGTGTGGGTAAATCCGAGGAGGGATTGAATATGGTGAAGGGTGCTAAGAATTTCTTGGACGCGTTTACGTATAATATTTCGCAGCACAGGAATT
TCCAAAGGGAGATGGATGGATTAACTAGTATGGTTGCTTATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGTCAGTTGTTGGTGTTACGATGCAAAAAGCTGGAGAAGCGGTAGCTTCAGCTATGTCGTCTAACAAGAAGGTTGCAGATATGCAGCCAGAAATCAGAGAACCCAGTAAAAACGAG
TGTCTTACCAGTGACTTTGGTGTTAAATCTGGTAATCATGATAAATGGCTATCTGCTTCGGATGGTGATCGCCAAGGTCCGTTATTGCTAGAGGATAACTTTGGAAGGGAGAAGATTATG
AAGTTCGATCATGAACGCATACCAGAACGAGTTGTCCATGCACGTGGTGCTGGAGCTTTTGGTAACTTCAAACTTTACGAGAGTGCTAAT
GATGTTACAAGTGCCGGGGTTCTTACAGAT
ACCTCTCGCACGACCCCAGTTTTCGTCCGCTTTTCGACAGTATTAGGTTCTCGTGGAAGTGCTGATACAGTCAGAGATGTGCGAGGTTTTGCTGTCAAATTTTATACTGACGAGGGTAAT
TGGGATATTGTTGGAAACGACATTCCGGTTTTCTTCATTCAAGATGCTTTTAAATTTCCCGATATCATTCATGCCGGAA
AGCCGGAACCTGATAATGAAATCCCTCAAGCCCAATCGGCA
CATAATAACTTTTGGGATTTCCAATTCTTACACACCGAAGCTACTCACATGTTTATGTGGGCCATGTCAGATCGAGGAATTCCAAGGTCTTATAGGATGATGCAAGGGTTCGGCGTCAAT
ACATATACTTTAATAAATGCCGAAGGCAAACGATCATTCGTAAAATTCCACTTCACCCCAACTCTAGGGGTTCATTCTCTAGTTTGGGATGAGGCATTAAAGATCGCTGGTCAAGATCCG
GATTTTCACCGCAAAGACCTCTGGACAGCTATTGAAAGTGGATCATACCCCAAATGGAAGTTCGGAATTCAAGTTTGCGAGGAAAGTCGTCAAGATGAATTTGACTTTGACATCTTGGAC
GCGACTAAAGTTTGGCCTGAAGATATTATCCCCGTCAGATACATTGGAGAACTGGAGCTCAACAAGAATGTTGATGAGTTTTTCTCACAAACAGAGCAAGCTGCTTTTTGCACCGCACAT
CTTGTGCCTGGCATTGGCTTTTCAGATGATCCTCTTCTTCAAGGCCGTAACTTCTCTTACTTTGATACCCAACTTTCACGCTTAGGTGTAAATTGGCAAGAGCTCCCTATAAACCGACCA
GTATGCCCTGTTATGAACAACCACCGAGACGGTCAAATGCGACACCGAATCACCAAAGGCAAGATTAATTACTGGCCGAATCGAGATACTGTCATTCCCCCAGCAAAGCAATCAGAGGGC
GCCTACTACGAATACCCTCAGAAGATTGCAGCCATGAAACAACGTCTCAGCTCCTCAAAATTCAAGGAACACTACAACCAAGCTCAATTATTCTGGAACTCAGTTTCTGAGGTTGAAAAG
TCTCACATTATCAATGCTCTAAGCTTCGAGCTTGATCACTGCGATGATCCTGTCGTATATGAACGTATGGTTGAACGACTAACAGATATTGATCTCTACCTAGCACAAGCCGTAGCTGAG
AAAGCTGGTGCCCCTACCCCTACTAAAGCGGGACGTCCCAATCACGGTAAAAAGACAAAAGGCCTTTCACAATTTGATTTTACTCCCGAAGCTCTAGGCTTACCAGCTACGATTAAATCT
CGTATGGTTGCAATTATTATTGCCGATGGCTTCAATTTCCTCGAATACGAAGCCGTAAAGGGAGCACTGACCGCAGCCGGCGCTCTTCCATTTACCATCGGTCCCAAGAGACAACCAATC
AACAGTTCTAGCGTCAAGAGCGTAAGTGCAGATCATCACTTCGAAGGTATGAGAAGTACATTGTTCGACGCTATCTACATTCCTGGCGGCGAACACGTTTCTACTTTACTCAAACAAGGA
CGAGTAATCCACTGGATCCGCGAAGCGTTCGGTCATTGTAAGGCTATTGGAGCCACAGGTGAAGGTGTAAAACTCGTACGAGCCGCATGTGAAGTTGAAGGTATGACATTTAGTACTTCT
GGCGAAGTGGTGGATTCGCATGGTGTTGTGACGGCCGAGGGTGTGGGTAAATCCGAGGAGGGATTGAATATGGTGAAGGGTGCTAAGAATTTCTTGGACGCGTTTACGTATAATATTTCG
CAGCACAGGAATTTCCAAAGGGAGATGGATGGATTAACTAGTATGGTTGCTTATTAG

Retrieve as FASTA