Entry information : PpaPrx36 (PP00047G01520)
Entry ID 6309
Creation 2008-08-06 (Christophe Dunand)
Last sequence changes 2008-08-06 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: PpaPrx36 (PP00047G01520)
Name (synonym) PpaPrx36 (PP00047G01520)
Class Class III peroxidase    [Orthogroup: Prx051]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaPrx36
start..stop
S start..stop
PpaPrx52 410 4e-145 3..317 4..316
PpaPrx06 410 4e-145 3..317 4..316
PpaPrx02 396 1e-139 6..317 6..317
PpaPrx[P]06 317 4e-109 22..281 21..279
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1727111..1727332 222 N° 2 1727555..1727900 346 N° 3 1728001..1728386 386  
join(1727111..1727332,1727555..1727900,1728001..1728386)


exon

Literature and cross-references PpaPrx36 (PP00047G01520)
Literature Rensing,S. et al., The genome of the moss Physcomitrella patens reveals evolutionary insights into the conquest of land by plants. Science (2008)
DNA ref. Phytozome 12:   scaffold_47 (1727111..1728386)
Protein sequence: PpaPrx36 (PP00047G01520)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   317 (290)
PWM (Da):   %s   34908.23 (32142.7) Transmb domain:   %s   i7-25o
PI (pH):   %s   9.25 (9.42) Peptide Signal:   %s   cut: 28 range:28-317
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDHPHRASLLALLIVVVLAVSVSSAEGQLVYRYYKQSCPNVEKIIHKEVLKQFKKDPTIAPGILRLIFHDCFVRGCDASVLLAGKDTERTSLTNANLHGFEAIDAIKAAVEKACPNTVSCADILAYASRDTVRITGGSSWKVYGGRRDGLISNAVEVAQNLPPSTAKVPELVATFAQKGLTPQQMVDLSGSHTLGVTHCVHLRDRIFTPIDPTMPKSLLKQLQRVCPKITSPTPLVIDRLTPHKFDTQYYQNIASGQGLMTSDQDLFNDDSTRRFVVKNLKHGNFIHRFGKAMIAMTNIEPTIAPDGEIRRRCQFLN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST. Ecotype="Gransden 2004".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCACCCTCACAGAGCTTCATTGTTGGCTTTGTTGATAGTGGTGGTGTTAGCCGTGAGCGTTAGCTCAGCCGAAGGACAGTTGGTATATAGGTATTACAAGCAGTCATGCCCGAAC
GTGGAGAAGATCATTCACAAGGAGGTCCTGAAACAATTCAAGAAGGACCCAACAATCGCTCCAGGAATCCTGCGTTTGATTTTCCACGATTGTTTCGTTCGA
GTAAGTAATCACATATTC
TCAGCCACTATAGTCACCATGCTCTCCAAGCAGGGGTTCAACTCTCCCATTTTGAATACAAGGGTGCTACTTGCTTTCCGGTGGCATTCACGTTCGATGGTTGGAAATATCACTCATCTG
CAATCGTATCCACACGTAGATTTCTACTGGAATATTGTCATGAATGGCAATGTCATGATCCCTGGGATTATCTTTTAATTGCAGGGTTGCGATGCATCCGTGCTCTTGGCTGGAAAGGAC
ACTGAAAGAACCTCCTTAACCAACGCTAATTTGCATGGATTTGAAGCCATCGACGCTATCAAGGCTGCAGTGGAGAAGGCTTGCCCCAACACCGTCTCTTGTGCAGATATTCTGGCTTAC
GCTTCTCGCGACACGGTGAGAATCACCGGGGGATCAAGCTGGAAAGTATACGGTGGACGGAGGGACGGGTTGATCTCTAACGCTGTCGAGGTCGCGCAAAACTTGCCTCCCTCCACGGCC
AAGGTTCCCGAGCTCGTTGCCACATTCGCACAGAAGGGGCTCACTCCGCAACAGATGGTCGACTTATCTG
GTACCTACTAGAACTCATTCTCCAGCGTTCAATTCTCCCAAACATATCGA
TCTATACTGAGATCCGCTTCGAACACATTTCTGAATCCGGAAAAATGCAGGTTCCCACACGCTCGGGGTCACACACTGCGTCCACCTCCGAGACAGGATCTTTACACCCATCGATCCAAC
CATGCCCAAGTCACTCTTGAAGCAGCTGCAACGGGTGTGTCCGAAGATCACCAGCCCAACTCCTCTTGTCATCGATCGTCTAACCCCACACAAGTTCGACACTCAGTATTATCAGAACAT
TGCGAGTGGCCAGGGTCTGATGACTTCGGACCAAGATCTGTTCAACGACGACAGTACCCGTCGCTTTGTGGTGAAGAACTTGAAGCACGGCAACTTCATCCACAGGTTCGGAAAGGCGAT
GATTGCCATGACCAACATCGAGCCCACCATCGCTCCTGATGGTGAAATCCGGAGGAGATGTCAGTTCCTGAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCACCCTCACAGAGCTTCATTGTTGGCTTTGTTGATAGTGGTGGTGTTAGCCGTGAGCGTTAGCTCAGCCGAAGGACAGTTGGTATATAGGTATTACAAGCAGTCATGCCCGAAC
GTGGAGAAGATCATTCACAAGGAGGTCCTGAAACAATTCAAGAAGGACCCAACAATCGCTCCAGGAATCCTGCGTTTGATTTTCCACGATTGTTTCGTTCGA
GGTTGCGATGCATCCGTG
CTCTTGGCTGGAAAGGACACTGAAAGAACCTCCTTAACCAACGCTAATTTGCATGGATTTGAAGCCATCGACGCTATCAAGGCTGCAGTGGAGAAGGCTTGCCCCAACACCGTCTCTTGT
GCAGATATTCTGGCTTACGCTTCTCGCGACACGGTGAGAATCACCGGGGGATCAAGCTGGAAAGTATACGGTGGACGGAGGGACGGGTTGATCTCTAACGCTGTCGAGGTCGCGCAAAAC
TTGCCTCCCTCCACGGCCAAGGTTCCCGAGCTCGTTGCCACATTCGCACAGAAGGGGCTCACTCCGCAACAGATGGTCGACTTATCTG
GTTCCCACACGCTCGGGGTCACACACTGCGTC
CACCTCCGAGACAGGATCTTTACACCCATCGATCCAACCATGCCCAAGTCACTCTTGAAGCAGCTGCAACGGGTGTGTCCGAAGATCACCAGCCCAACTCCTCTTGTCATCGATCGTCTA
ACCCCACACAAGTTCGACACTCAGTATTATCAGAACATTGCGAGTGGCCAGGGTCTGATGACTTCGGACCAAGATCTGTTCAACGACGACAGTACCCGTCGCTTTGTGGTGAAGAACTTG
AAGCACGGCAACTTCATCCACAGGTTCGGAAAGGCGATGATTGCCATGACCAACATCGAGCCCACCATCGCTCCTGATGGTGAAATCCGGAGGAGATGTCAGTTCCTGAACTAG

Retrieve as FASTA