Entry information : PpaPrx39 (PP00026G00470)
Entry ID 6312
Creation 2008-08-07 (Christophe Dunand)
Last sequence changes 2011-09-04 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: PpaPrx39 (PP00026G00470)
Name (synonym) PpaPrx39 (PP00026G00470)
Class Class III peroxidase    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaPrx39
start..stop
S start..stop
GbPrx04 335 3e-115 11..335 7..329
SmPrx106-2_43 326 4e-111 34..331 58..355
SmPrx106-1_173 325 8e-111 34..331 54..351
GhPrx22 321 2e-109 34..335 30..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 686729..686965 237 N° 2 686038..686229 192 N° 3 685706..685871 166 N° 4 685162..685577 416
complement(join(685162..685577,685706..685871,686038..686229,686729..686965))


exon

Literature and cross-references PpaPrx39 (PP00026G00470)
Literature Rensing,S. et al., The genome of the moss Physcomitrella patens reveals evolutionary insights into the conquest of land by plants. Science (2008).
DNA ref. Phytozome 12:   scaffold_26 (686965..685162)
EST ref. GenBank:   BY981065.1 [5' end]
Cluster/Prediction ref. UniGene:   Ppa.10850 [3' end]
Protein sequence: PpaPrx39 (PP00026G00470)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   336 (310)
PWM (Da):   %s   36674.42 (33921.0) Transmb domain:   %s   i7-24o
PI (pH):   %s   6.04 (6.36) Peptide Signal:   %s   cut: 27 range:27-336
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDACYSSSTVVLLLLVLSCMQLVVQGSLDNQYGLRKSYYGVSCPNAEEIVTKTVTKAVKHDSRSAASLVRLFFHDCFVSGCDGSVLLDNSTTAMSEKEARPNINTLRGFGIIERIKESLENACSETVSCADILALAARDSVVQTGGPHYDVLLGRRDSIIANYTGANAVLPSPKFNVTTLTKKFLDVGLTSEDMVTLSGAHTIGKTHCTSITTRLYNQSGTTKPDPAIPAEMLRKLQTKCPNDPTDLKTTLVLDDETPEVFDNQYFKNLLNKRGILYSDQILADTEGFNLDLVNLYANDQNAFFDAFVKSMTRMGNISPLMGTSGEIRKRCDRVNL

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and 5 ESTs. Ecotype="Gransden 2004".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATGCCTGCTACTCCTCGTCGACGGTGGTGTTGCTTCTGTTGGTGTTGAGCTGCATGCAATTGGTTGTACAAGGCTCCTTAGATAACCAATACGGTCTCAGAAAATCCTACTACGGG
GTCTCGTGTCCCAACGCCGAGGAGATTGTTACTAAAACTGTGACCAAAGCAGTGAAACACGACTCCCGATCAGCTGCTTCACTTGTGCGCTTATTTTTCCATGACTGCTTTGTCTCG
GTA
CCGATGGACTTCGCTCTTTTCCTCAATTCGCCAATGCCCATAACTGAATCTAGAATTTTGCATGCAGTAAACGAGATATACATCATTATGTCAAGTTANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCATATTAATTTTCCAAGCTCCAGAACAATTGCGCAAACATTAAGTATCAACATGTCTTGGTTTTTAAAGGTCATAGAGTATGAGCCTGACGTGT
TTAGAGGGTAGAAAATTGCTAATTCAATGAATATCTCTCTGTTCGTGTTTCTGTGGAAATTGTCCACCTGGGGTAATCGAGAGCTTTGTCTTTCATGTAATTCGAACTAAAGGAATTTCT
ACTGGTCAATGCCTTAGTTTATCTGAAACTGAGTTTCGCGGACCTTTTGAGTTAGAAATTGAGTCTTGCTGAAGCGTTCTATGGTCATACACTCCAACGTTGTAACAAGCAATTGCACAC
TGATTGCTGCGCCCAGGGTTGCGATGGATCGGTGCTGCTGGATAATTCCACCACAGCAATGAGTGAGAAAGAGGCTCGTCCCAACATCAACACATTACGCGGATTCGGAATCATTGAGCG
CATCAAGGAATCGCTTGAGAATGCTTGCAGTGAAACCGTCTCATGTGCTGACATATTAGCTCTTGCTGCCCGAGATTCTGTCGTTCAG
GTAACCAAAATTCAGTCTCATGAATTGAGTTA
ATCCCATAAGATGGCCAAAAGAGTCAACGAATTCTTCCCAGGACTTCTGAGATTAGGACTACACTTCTGAGCAAGAGATTTGACTGGGCAACTTCAACGCATGAATTGATGACATTAGAT
TTAATATGTGGCAGACTGGAGGGCCCCATTACGACGTATTGCTGGGTAGACGAGATAGCATCATAGCCAACTATACTGGTGCTAATGCTGTGCTTCCGTCACCAAAATTCAACGTTACGA
CTCTCACGAAAAAATTTCTTGACGTCGGCTTGACCTCGGAGGATATGGTCACTCTATCAG
GTTGGCATTCGAACCTCGTTTGGAGCTCACGCTTCTCGTTGTGCTACGACACTGGTAGAA
ATCAACGATTCACGATTTTCTCATGCAGTTGTTGAGAAATTTCAAGTGATGTTTGCTCATTTTCACAGGTGCCCACACAATTGGCAAGACTCACTGTACCTCGATCACAACTCGCCTCTA
TAATCAAAGCGGAACCACCAAGCCCGATCCCGCCATTCCAGCGGAGATGCTCAGAAAGCTGCAAACCAAGTGCCCGAACGACCCTACCGACCTCAAAACAACACTCGTTCTGGACGACGA
GACTCCCGAAGTCTTCGACAATCAGTACTTCAAAAATCTTCTAAACAAACGAGGTATTCTGTATTCAGATCAAATTCTGGCAGACACGGAAGGGTTCAACCTCGACTTAGTGAACTTGTA
TGCCAACGACCAGAACGCTTTCTTCGACGCATTCGTAAAATCGATGACGAGGATGGGAAACATCAGCCCTCTGATGGGAACGAGCGGCGAAATCCGCAAACGATGCGACAGAGTGAATCT
GTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATGCCTGCTACTCCTCGTCGACGGTGGTGTTGCTTCTGTTGGTGTTGAGCTGCATGCAATTGGTTGTACAAGGCTCCTTAGATAACCAATACGGTCTCAGAAAATCCTACTACGGG
GTCTCGTGTCCCAACGCCGAGGAGATTGTTACTAAAACTGTGACCAAAGCAGTGAAACACGACTCCCGATCAGCTGCTTCACTTGTGCGCTTATTTTTCCATGACTGCTTTGTCTCG
GGT
TGCGATGGATCGGTGCTGCTGGATAATTCCACCACAGCAATGAGTGAGAAAGAGGCTCGTCCCAACATCAACACATTACGCGGATTCGGAATCATTGAGCGCATCAAGGAATCGCTTGAG
AATGCTTGCAGTGAAACCGTCTCATGTGCTGACATATTAGCTCTTGCTGCCCGAGATTCTGTCGTTCAG
ACTGGAGGGCCCCATTACGACGTATTGCTGGGTAGACGAGATAGCATCATA
GCCAACTATACTGGTGCTAATGCTGTGCTTCCGTCACCAAAATTCAACGTTACGACTCTCACGAAAAAATTTCTTGACGTCGGCTTGACCTCGGAGGATATGGTCACTCTATCAG
GTGCC
CACACAATTGGCAAGACTCACTGTACCTCGATCACAACTCGCCTCTATAATCAAAGCGGAACCACCAAGCCCGATCCCGCCATTCCAGCGGAGATGCTCAGAAAGCTGCAAACCAAGTGC
CCGAACGACCCTACCGACCTCAAAACAACACTCGTTCTGGACGACGAGACTCCCGAAGTCTTCGACAATCAGTACTTCAAAAATCTTCTAAACAAACGAGGTATTCTGTATTCAGATCAA
ATTCTGGCAGACACGGAAGGGTTCAACCTCGACTTAGTGAACTTGTATGCCAACGACCAGAACGCTTTCTTCGACGCATTCGTAAAATCGATGACGAGGATGGGAAACATCAGCCCTCTG
ATGGGAACGAGCGGCGAAATCCGCAAACGATGCGACAGAGTGAATCTGTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTTGGAAAAT TGATGATGTA GAGATTCGAG AAGGTGCAAT TGTATCAGAT GAAGATGTTG TTGATATTGC TAGAATAGGG ATGAGGTTGG AATACAGCGC TGGTTGCTTA CGTTGTGAAG  GCATTTTTTT ATCTCGGTTG AAGACTAAAG TTAGTCGGGG GATTAGAGGT TGTGAGTTTG GAAGAGGGGT ACTCACATCA GCTGTCAGAT GGATGCCTGC TACTCCTCGT CGACGGTGGT  GTTGCTTCTG TTGGTGTTGA GCTGCATGCA ATTGGTTGTA CAAGGCTCCT TAGATAACCA ATACGGTCTC AGAAAATCCT ACTACGGGGT CTCGTGTCCC AACGCCGAGG AGATTGTTAC  TAAAACTGTG ACCAAAGCAG TGAAACACGA CTCCCGATCA GCTGCTTCAC TTGTGCGCTT ATTTTTCCAT GACTGCTTTG TCTCGGGTTG CGATGGATCG GTGCTGCTGG ATAATTCCAC  CACAGCAATG AGTGAGAAAG AGGCTCGTCC CAACATCAAC ACATTACGCG GATTCGGAAT CATTGAGCGC ATCAAGGAAT CGCTTGAGGA TGCTTGCAGT GAAACCGTCT CATGTGCTGA  CATATTAGCT CTTGCTGCCC GAGATTCTGT CGTTCAGACT GGACTGGAGG GCCCCATTAC GACGTATTGC TGGGTAGACG AGATAGCATC ATAGCCAACT ATACTGGTGC TAATGCTGTG  CTTCCGTCAC CAAAATTCAA CGTTACGACT CTCACGAAAA AATTTCTTGA CGTCGGCTTG ACCTCGGAGG ATATGGTCAC TCTATCAGGT GCCCACACAA TTGGCAAGAC TCACTGTACC  TCGATCACAA CTCGCCTCCA TAATCAAAGC GGAACCACCA AGCCCGATCC CGCCATTCCA GCGGAGATGC TCAGAAAGCT GCAAACCAAG TGCCCGAACG ACCCTACCGA CCTCAAAACA  ACACTCGTTC TGGACGACGA GACTCCCGAA GTCTTCGACA ATCAGTACTT CAAAAATCTT CTAAACAAAC GAGGTATTCT GTATTCAGAT CAAATTCTGG CAGACACGGA AGGGTTCAAC  CTCGACTTAG TGAACTTGTA TGCCAACGAC CAGAACGCTT TCTTCGACGC ATTCGTAAAA TCGATGACGA GGATGGGAAA CATCAGCCCT CTGATGGGAA CGAGCGGCGA AATCCGCAAA  CGATGCGACA GAGTGAATCT GTAAAAAGAA AACTGCTACA CATCGGTATA ACTCAGTTTA GATTCGTCTA ATTGCAGGTG GTGTGCAGTT CTGGTGCTCA AGAGTGCAGG CCTCTCTTCA 
GACACAAGTC TGAGAGGGGT CGAGAAATAA ACTCCTGGAA CAAGTGAGCT GTTCTCGCAT GCGATGTAGT CACTGTACAA TATGAAGGAA ACCATTCACC 

Retrieve as FASTA